Incidental Mutation 'R7270:Spef2'
ID565254
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 9599980 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect probably benign
Transcript: ENSMUST00000160236
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
R7838:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9717563 missense probably damaging 1.00
R7921:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7937:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7938:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7972:Spef2 UTSW 15 9717563 missense probably damaging 1.00
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGCATCAGGACACTTGG -3'
(R):5'- AATCAAGGTAACCTATAGGCGCC -3'

Sequencing Primer
(F):5'- GCATCAGGACACTTGGATATTTATGG -3'
(R):5'- GCCAATAAGCCAGTGCCTTTTG -3'
Posted On2019-06-26