Incidental Mutation 'R7270:Pde1b'
ID565260
Institutional Source Beutler Lab
Gene Symbol Pde1b
Ensembl Gene ENSMUSG00000022489
Gene Namephosphodiesterase 1B, Ca2+-calmodulin dependent
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location103503034-103530052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103521655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 137 (M137K)
Ref Sequence ENSEMBL: ENSMUSP00000023132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023132] [ENSMUST00000226468] [ENSMUST00000226493] [ENSMUST00000227955]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023132
AA Change: M137K

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023132
Gene: ENSMUSG00000022489
AA Change: M137K

DomainStartEndE-ValueType
coiled coil region 38 60 N/A INTRINSIC
Pfam:PDEase_I_N 76 136 1.2e-33 PFAM
HDc 219 383 8.77e-5 SMART
Blast:HDc 394 443 1e-20 BLAST
low complexity region 467 478 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226468
AA Change: M137K

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226493
AA Change: M137K

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000227955
AA Change: M118K

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased exploratory behavior. Learning deficits and hyperactivity are also observed in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Sec31b T C 19: 44,523,043 T640A probably benign Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Pde1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pde1b APN 15 103526680 missense probably damaging 1.00
IGL01539:Pde1b APN 15 103525345 splice site probably benign
IGL01988:Pde1b APN 15 103524856 unclassified probably null
IGL02380:Pde1b APN 15 103519990 missense possibly damaging 0.80
IGL02424:Pde1b APN 15 103528219 splice site probably benign
IGL02710:Pde1b APN 15 103522057 missense probably damaging 1.00
R0111:Pde1b UTSW 15 103503513 missense probably benign
R1302:Pde1b UTSW 15 103527599 missense probably benign 0.12
R1312:Pde1b UTSW 15 103526273 missense possibly damaging 0.71
R1449:Pde1b UTSW 15 103525043 missense probably damaging 0.99
R1631:Pde1b UTSW 15 103521672 missense probably damaging 0.97
R1848:Pde1b UTSW 15 103525340 splice site probably null
R4032:Pde1b UTSW 15 103521326 missense probably damaging 1.00
R4896:Pde1b UTSW 15 103521374 missense probably damaging 1.00
R4901:Pde1b UTSW 15 103526685 missense probably null 0.92
R5052:Pde1b UTSW 15 103527648 missense possibly damaging 0.76
R5935:Pde1b UTSW 15 103521439 missense possibly damaging 0.81
R6117:Pde1b UTSW 15 103521482 missense probably damaging 0.99
R7092:Pde1b UTSW 15 103527031 missense probably benign 0.02
R7116:Pde1b UTSW 15 103528318 missense possibly damaging 0.82
R7359:Pde1b UTSW 15 103521325 missense probably damaging 1.00
R7464:Pde1b UTSW 15 103524829 missense probably benign 0.05
R7980:Pde1b UTSW 15 103503589 splice site probably null
R8058:Pde1b UTSW 15 103524811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGAGGTTTGCCCATTCTC -3'
(R):5'- CCAGGTATCTCTCAGTACCAGAG -3'

Sequencing Primer
(F):5'- GAGGTTTGCCCATTCTCAACCTC -3'
(R):5'- CTTGAGACAGTTGTGGAC -3'
Posted On2019-06-26