Incidental Mutation 'R7270:Sec31b'
ID565268
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7270 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44523043 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 640 (T640A)
Ref Sequence ENSEMBL: ENSMUSP00000107616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]
Predicted Effect probably benign
Transcript: ENSMUST00000063632
AA Change: T797A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: T797A

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
AA Change: T640A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: T640A

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165758
SMART Domains Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l A T 10: 42,425,249 Y193N probably damaging Het
Ahnak2 A T 12: 112,780,802 V70E Het
Aimp1 T C 3: 132,677,011 K44E probably damaging Het
Arid1b T A 17: 4,996,043 Y369N unknown Het
Art5 A T 7: 102,097,873 V233D probably damaging Het
Baz2b T A 2: 59,962,492 N431Y possibly damaging Het
Bik T A 15: 83,544,163 F131I possibly damaging Het
Bmpr1a A G 14: 34,441,125 Y103H probably damaging Het
Cabp7 C T 11: 4,746,676 V18M possibly damaging Het
Cacna1a C A 8: 84,571,237 T1240N probably damaging Het
Cacna1h A G 17: 25,384,765 V1311A probably damaging Het
Cbarp A C 10: 80,137,317 S16A possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces2b A T 8: 104,837,840 H494L possibly damaging Het
Cfap43 T A 19: 47,739,785 H1511L possibly damaging Het
Cfap54 A G 10: 92,839,458 V2867A probably benign Het
Col5a1 C T 2: 27,997,585 P956L unknown Het
Dcakd T G 11: 103,000,206 Q19P possibly damaging Het
Ddx47 T A 6: 135,023,338 D432E probably benign Het
Dhrs7b T C 11: 60,844,229 F29L probably benign Het
Dis3l2 A T 1: 86,990,303 D558V possibly damaging Het
Dtx3l T A 16: 35,933,657 D193V probably damaging Het
Epha4 G A 1: 77,399,785 R486C probably damaging Het
Fam186a T C 15: 99,944,152 T1404A possibly damaging Het
Fat1 A G 8: 45,037,438 T3796A probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Ftmt A G 18: 52,332,019 I136V probably benign Het
Gm10300 T C 4: 132,074,856 W54R unknown Het
Gm10518 C T 1: 179,803,384 P3L unknown Het
Gm5788 T C 12: 87,494,893 L58P probably damaging Het
Gm9733 A T 3: 15,320,644 I66N probably benign Het
Grm2 G A 9: 106,651,058 T209M probably damaging Het
Gtdc1 C T 2: 44,635,310 M176I probably benign Het
Insrr T C 3: 87,803,133 L382P probably damaging Het
Jade2 A G 11: 51,817,184 V734A possibly damaging Het
Kcnh4 C T 11: 100,747,646 R586H probably benign Het
Kdm1a A T 4: 136,552,527 D721E probably damaging Het
Knl1 G A 2: 119,102,522 C2054Y possibly damaging Het
Lrrk2 C T 15: 91,700,441 P354S probably benign Het
Luzp2 A G 7: 55,075,026 I112V probably damaging Het
Mgl2 T C 11: 70,135,680 S105P probably damaging Het
Mocs1 T A 17: 49,449,115 M200K possibly damaging Het
Oat T A 7: 132,567,198 I98L probably benign Het
Obscn T C 11: 59,029,486 Y8C Het
Olfr1462 G A 19: 13,191,404 V246I possibly damaging Het
Olfr786 T G 10: 129,437,450 F213V probably benign Het
Pde1b T A 15: 103,521,655 M137K possibly damaging Het
Phf21a T C 2: 92,327,139 I204T probably damaging Het
Plcd4 A G 1: 74,554,679 E321G possibly damaging Het
Plpp7 C T 2: 32,095,650 probably benign Het
Prdm1 A G 10: 44,441,570 I419T probably benign Het
Sec16b A T 1: 157,564,462 R855W probably damaging Het
Sec16b G T 1: 157,564,463 R855M probably damaging Het
Siglec1 T C 2: 131,081,551 T425A possibly damaging Het
Skil T C 3: 31,097,175 probably benign Het
Slc1a5 G A 7: 16,785,698 V200M probably damaging Het
Slc25a12 T C 2: 71,324,025 H139R probably benign Het
Slc25a32 A T 15: 39,098,235 V187D probably damaging Het
Slc35a3 G A 3: 116,711,806 probably benign Het
Smap2 C A 4: 120,972,067 M328I probably benign Het
Spef2 C T 15: 9,599,980 probably null Het
Srarp A G 4: 141,433,078 V148A possibly damaging Het
Stard9 T A 2: 120,634,274 Y73* probably null Het
Tars A G 15: 11,392,019 C236R probably benign Het
Tchh G C 3: 93,444,530 D426H unknown Het
Tnks2 T C 19: 36,859,145 F17S Het
Ube2g1 T C 11: 72,663,113 I30T possibly damaging Het
Ube2o C T 11: 116,543,935 D567N possibly damaging Het
Unc5b A T 10: 60,772,223 Y710* probably null Het
Vmn1r215 T C 13: 23,075,919 V43A possibly damaging Het
Xkr8 A G 4: 132,728,337 F242L probably benign Het
Zfp526 T A 7: 25,225,920 C535S probably damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7505:Sec31b UTSW 19 44543707 missense probably damaging 1.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 splice site probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7952:Sec31b UTSW 19 44520540 missense probably benign 0.01
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
R8197:Sec31b UTSW 19 44524516 missense probably benign 0.25
R8739:Sec31b UTSW 19 44519181 missense probably benign 0.16
R8822:Sec31b UTSW 19 44519263 missense probably benign 0.02
R8837:Sec31b UTSW 19 44517667 nonsense probably null
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCGACTCTCGAATGGTTC -3'
(R):5'- TAAGCAGTAATCCAGTGTCTGATG -3'

Sequencing Primer
(F):5'- ACTCTCGAATGGTTCTGTGAAGC -3'
(R):5'- TCCAGTGTCTGATGAAAGAGCC -3'
Posted On2019-06-26