Incidental Mutation 'R0583:Cast'
ID56527
Institutional Source Beutler Lab
Gene Symbol Cast
Ensembl Gene ENSMUSG00000021585
Gene Namecalpastatin
Synonyms
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0583 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location74692368-74808810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74713678 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 629 (T629A)
Ref Sequence ENSEMBL: ENSMUSP00000152174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000220738] [ENSMUST00000222588] [ENSMUST00000223033] [ENSMUST00000223126] [ENSMUST00000223206] [ENSMUST00000223309]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065629
AA Change: T595A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585
AA Change: T595A

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220738
AA Change: T287A

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222588
AA Change: T527A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223033
AA Change: T546A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223126
AA Change: T527A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000223206
AA Change: T629A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000223309
AA Change: T272A

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Cast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cast APN 13 74736974 missense probably damaging 1.00
IGL01363:Cast APN 13 74704192 missense possibly damaging 0.95
IGL01404:Cast APN 13 74738287 nonsense probably null
IGL01893:Cast APN 13 74727289 nonsense probably null
IGL02139:Cast APN 13 74728365 missense possibly damaging 0.80
IGL02444:Cast APN 13 74739853 missense probably damaging 1.00
IGL02927:Cast APN 13 74736994 missense probably damaging 1.00
IGL02941:Cast APN 13 74700687 missense probably damaging 1.00
IGL02799:Cast UTSW 13 74736752 missense probably damaging 1.00
R2031:Cast UTSW 13 74798652 splice site probably null
R2256:Cast UTSW 13 74739905 missense probably damaging 0.99
R2509:Cast UTSW 13 74737616 missense probably benign 0.19
R3923:Cast UTSW 13 74728413 missense probably damaging 1.00
R4116:Cast UTSW 13 74724837 missense probably damaging 1.00
R4649:Cast UTSW 13 74746014 missense probably benign 0.25
R4651:Cast UTSW 13 74746014 missense probably benign 0.25
R4652:Cast UTSW 13 74746014 missense probably benign 0.25
R4653:Cast UTSW 13 74746014 missense probably benign 0.25
R4714:Cast UTSW 13 74798715 missense probably damaging 1.00
R4751:Cast UTSW 13 74746047 missense probably damaging 1.00
R4758:Cast UTSW 13 74739880 missense possibly damaging 0.90
R4974:Cast UTSW 13 74807823 missense probably benign
R5040:Cast UTSW 13 74724813 missense probably damaging 1.00
R5397:Cast UTSW 13 74720937 missense possibly damaging 0.83
R5556:Cast UTSW 13 74695889 critical splice donor site probably null
R5863:Cast UTSW 13 74736756 missense probably damaging 1.00
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6349:Cast UTSW 13 74721195 missense probably damaging 1.00
R6817:Cast UTSW 13 74699158 missense possibly damaging 0.78
R6829:Cast UTSW 13 74728344 missense possibly damaging 0.50
R6848:Cast UTSW 13 74695933 missense possibly damaging 0.66
R7275:Cast UTSW 13 74727334 missense probably benign 0.00
R7401:Cast UTSW 13 74808458 missense unknown
R7408:Cast UTSW 13 74739841 missense probably damaging 0.99
R7602:Cast UTSW 13 74736965 missense probably benign 0.26
R8032:Cast UTSW 13 74735241 nonsense probably null
X0011:Cast UTSW 13 74725456 missense probably damaging 1.00
X0066:Cast UTSW 13 74736979 missense probably damaging 1.00
Z1177:Cast UTSW 13 74725463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGCTTCACTATGGGAACTTCTGAT -3'
(R):5'- TGGAGATGCTATGAGGCATGTACTTGA -3'

Sequencing Primer
(F):5'- CTTCTGATAGCAAATGAAGCACTTCC -3'
(R):5'- TATGAGGCATGTACTTGAATAAAAGG -3'
Posted On2013-07-11