Incidental Mutation 'R7271:Ttll4'
ID 565270
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
MMRRC Submission 045356-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R7271 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74700804-74740991 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 74727820 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 861 (I861F)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000042125
AA Change: I861F

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I861F

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: I797F
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I797F

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l C T 10: 42,291,544 (GRCm39) probably null Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
Alpk3 A G 7: 80,728,202 (GRCm39) E444G possibly damaging Het
Amer2 T A 14: 60,617,123 (GRCm39) D439E possibly damaging Het
Ano6 A G 15: 95,811,781 (GRCm39) Y222C probably damaging Het
Atp4a A C 7: 30,421,944 (GRCm39) K827Q probably benign Het
Atp9a G A 2: 168,576,047 (GRCm39) Het
Casp7 T A 19: 56,424,793 (GRCm39) C171S probably damaging Het
Ccdc9b T A 2: 118,591,164 (GRCm39) probably null Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cdkl1 A G 12: 69,795,585 (GRCm39) L315S probably benign Het
Cfap91 A G 16: 38,148,708 (GRCm39) I240T probably damaging Het
Crybg1 G T 10: 43,873,619 (GRCm39) S1163* probably null Het
Csmd1 A T 8: 17,077,295 (GRCm39) W121R probably damaging Het
Cyyr1 A T 16: 85,262,493 (GRCm39) M88K possibly damaging Het
Dlc1 T C 8: 37,049,954 (GRCm39) Q587R probably damaging Het
Dock2 T C 11: 34,223,750 (GRCm39) E1128G possibly damaging Het
Dynap T A 18: 70,374,320 (GRCm39) T69S possibly damaging Het
Esr1 T C 10: 4,733,874 (GRCm39) C225R probably damaging Het
Fbxo31 C T 8: 122,305,503 (GRCm39) probably benign Het
Fndc11 G A 2: 180,863,893 (GRCm39) V233I possibly damaging Het
Fto T C 8: 92,211,818 (GRCm39) F381S probably damaging Het
Gtf2ird1 A G 5: 134,433,758 (GRCm39) L223P probably benign Het
Ifi214 A T 1: 173,357,042 (GRCm39) H20Q probably damaging Het
Impa2 T A 18: 67,439,806 (GRCm39) I101N probably damaging Het
Kidins220 A T 12: 25,061,570 (GRCm39) T854S probably benign Het
Lamb1 T A 12: 31,337,423 (GRCm39) C385S probably damaging Het
Lrrc8c A G 5: 105,755,853 (GRCm39) S543G probably benign Het
Manba A T 3: 135,248,137 (GRCm39) Y342F probably damaging Het
Map3k1 T C 13: 111,893,231 (GRCm39) D758G probably benign Het
Mtor G T 4: 148,630,942 (GRCm39) A2300S possibly damaging Het
Musk T A 4: 58,373,409 (GRCm39) M793K probably damaging Het
Nup133 A C 8: 124,649,153 (GRCm39) I563S probably benign Het
Or10ab4 G A 7: 107,654,423 (GRCm39) R78Q probably damaging Het
Or10ag55-ps1 T A 2: 87,114,725 (GRCm39) N30K probably benign Het
Or4k77 A G 2: 111,199,693 (GRCm39) T239A probably damaging Het
Or8g21 A T 9: 38,905,953 (GRCm39) Y259* probably null Het
Pcdh12 C A 18: 38,416,100 (GRCm39) V342F probably damaging Het
Pcdhb4 T A 18: 37,441,222 (GRCm39) H177Q possibly damaging Het
Pcnx2 G A 8: 126,613,690 (GRCm39) A587V probably benign Het
Phkb C T 8: 86,770,418 (GRCm39) P896S probably damaging Het
Prss36 A G 7: 127,543,877 (GRCm39) S165P probably benign Het
Prss43 A G 9: 110,657,671 (GRCm39) D190G probably damaging Het
Psmd14 T C 2: 61,591,356 (GRCm39) V53A probably damaging Het
Sel1l3 T G 5: 53,273,704 (GRCm39) H1054P probably damaging Het
Selenoh T C 2: 84,500,631 (GRCm39) R70G probably damaging Het
Serpinb9d A G 13: 33,378,617 (GRCm39) Q21R probably benign Het
Slc29a1 T C 17: 45,899,288 (GRCm39) E262G probably benign Het
Slc7a14 A G 3: 31,278,384 (GRCm39) L407P probably damaging Het
Smyd4 T C 11: 75,281,325 (GRCm39) V266A possibly damaging Het
Spata31d1a T A 13: 59,849,913 (GRCm39) R738S probably benign Het
Speer4a2 G A 5: 26,292,993 (GRCm39) T67I probably benign Het
Srcin1 C T 11: 97,442,715 (GRCm39) G38S probably damaging Het
Stab2 A T 10: 86,838,972 (GRCm39) probably null Het
Syde2 A G 3: 145,726,031 (GRCm39) N1308D possibly damaging Het
Trip11 A T 12: 101,850,611 (GRCm39) M1151K probably damaging Het
Zfp319 G A 8: 96,058,471 (GRCm39) probably benign Het
Zfp518b T C 5: 38,831,907 (GRCm39) N33D probably benign Het
Zfp874a T A 13: 67,591,415 (GRCm39) I90F probably benign Het
Zmiz2 G T 11: 6,349,593 (GRCm39) V412L probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74,725,052 (GRCm39) missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74,727,352 (GRCm39) missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74,718,217 (GRCm39) missense probably benign 0.01
IGL02288:Ttll4 APN 1 74,718,560 (GRCm39) missense probably benign 0.05
IGL02621:Ttll4 APN 1 74,726,643 (GRCm39) missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74,726,390 (GRCm39) splice site probably null
IGL02890:Ttll4 APN 1 74,726,498 (GRCm39) nonsense probably null
IGL02937:Ttll4 APN 1 74,718,662 (GRCm39) missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74,719,567 (GRCm39) missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74,726,480 (GRCm39) missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74,729,139 (GRCm39) missense probably null 1.00
R0083:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0108:Ttll4 UTSW 1 74,718,928 (GRCm39) missense probably benign 0.13
R0135:Ttll4 UTSW 1 74,719,087 (GRCm39) missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74,718,851 (GRCm39) missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74,735,916 (GRCm39) missense probably benign 0.28
R0506:Ttll4 UTSW 1 74,727,777 (GRCm39) missense probably benign 0.06
R0555:Ttll4 UTSW 1 74,727,439 (GRCm39) missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74,718,560 (GRCm39) missense probably benign 0.05
R1649:Ttll4 UTSW 1 74,736,629 (GRCm39) missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74,726,999 (GRCm39) missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74,736,641 (GRCm39) missense probably benign 0.01
R1952:Ttll4 UTSW 1 74,726,718 (GRCm39) missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74,724,527 (GRCm39) missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74,719,541 (GRCm39) missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74,718,988 (GRCm39) missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2876:Ttll4 UTSW 1 74,725,597 (GRCm39) splice site probably null
R2895:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74,724,517 (GRCm39) missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74,736,770 (GRCm39) missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74,725,550 (GRCm39) missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74,718,166 (GRCm39) missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74,718,445 (GRCm39) missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74,727,011 (GRCm39) critical splice donor site probably null
R5244:Ttll4 UTSW 1 74,735,607 (GRCm39) missense probably benign 0.30
R5264:Ttll4 UTSW 1 74,725,535 (GRCm39) missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74,718,480 (GRCm39) missense probably benign 0.06
R5992:Ttll4 UTSW 1 74,724,550 (GRCm39) missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74,736,698 (GRCm39) missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74,720,948 (GRCm39) missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74,720,512 (GRCm39) missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74,718,508 (GRCm39) missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74,728,572 (GRCm39) missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 1.00
R7508:Ttll4 UTSW 1 74,726,418 (GRCm39) missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74,718,572 (GRCm39) missense probably benign 0.00
R7837:Ttll4 UTSW 1 74,720,916 (GRCm39) critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74,735,632 (GRCm39) missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74,718,389 (GRCm39) missense probably benign 0.02
R8115:Ttll4 UTSW 1 74,726,489 (GRCm39) nonsense probably null
R8949:Ttll4 UTSW 1 74,720,975 (GRCm39) missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74,718,949 (GRCm39) missense probably benign 0.02
R9156:Ttll4 UTSW 1 74,719,225 (GRCm39) missense probably benign 0.00
R9329:Ttll4 UTSW 1 74,725,121 (GRCm39) missense possibly damaging 0.85
R9701:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
R9802:Ttll4 UTSW 1 74,720,482 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AACGTATCTGTGTACCTCATACTC -3'
(R):5'- AAAGTCTAACCGTTCTCTGCTTTG -3'

Sequencing Primer
(F):5'- GTATCTGTGTACCTCATACTCCTTAC -3'
(R):5'- GTGCTAACTCCCTGGAATCCTAAG -3'
Posted On 2019-06-26