Mutagenetix > Incidental Mutation

Incidental Mutation 'R7271:Ttll4'

565270

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R7271 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74688661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 861 (I861F)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042125
AA Change: I861F

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I861F

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113678
AA Change: I797F

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I797F

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (58/58)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	A	2: 118,760,683		probably null	Het
Afg1l	C	T	10: 42,415,548		probably null	Het
Ahnak2	A	T	12: 112,780,802	V70E		Het
Alpk3	A	G	7: 81,078,454	E444G	possibly damaging	Het
Amer2	T	A	14: 60,379,674	D439E	possibly damaging	Het
Ano6	A	G	15: 95,913,900	Y222C	probably damaging	Het
Atp4a	A	C	7: 30,722,519	K827Q	probably benign	Het
Atp9a	G	A	2: 168,734,127			Het
Casp7	T	A	19: 56,436,361	C171S	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdkl1	A	G	12: 69,748,811	L315S	probably benign	Het
Crybg1	G	T	10: 43,997,623	S1163*	probably null	Het
Csmd1	A	T	8: 17,027,279	W121R	probably damaging	Het
Cyyr1	A	T	16: 85,465,605	M88K	possibly damaging	Het
Dlc1	T	C	8: 36,582,800	Q587R	probably damaging	Het
Dock2	T	C	11: 34,273,750	E1128G	possibly damaging	Het
Dynap	T	A	18: 70,241,249	T69S	possibly damaging	Het
Esr1	T	C	10: 4,783,874	C225R	probably damaging	Het
Fbxo31	C	T	8: 121,578,764		probably benign	Het
Fndc11	G	A	2: 181,222,100	V233I	possibly damaging	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gm10471	G	A	5: 26,087,995	T67I	probably benign	Het
Gtf2ird1	A	G	5: 134,404,904	L223P	probably benign	Het
Ifi214	A	T	1: 173,529,476	H20Q	probably damaging	Het
Impa2	T	A	18: 67,306,736	I101N	probably damaging	Het
Kidins220	A	T	12: 25,011,571	T854S	probably benign	Het
Lamb1	T	A	12: 31,287,424	C385S	probably damaging	Het
Lrrc8c	A	G	5: 105,607,987	S543G	probably benign	Het
Maats1	A	G	16: 38,328,346	I240T	probably damaging	Het
Manba	A	T	3: 135,542,376	Y342F	probably damaging	Het
Map3k1	T	C	13: 111,756,697	D758G	probably benign	Het
Mtor	G	T	4: 148,546,485	A2300S	possibly damaging	Het
Musk	T	A	4: 58,373,409	M793K	probably damaging	Het
Nup133	A	C	8: 123,922,414	I563S	probably benign	Het
Olfr1117-ps1	T	A	2: 87,284,381	N30K	probably benign	Het
Olfr1283	A	G	2: 111,369,348	T239A	probably damaging	Het
Olfr479	G	A	7: 108,055,216	R78Q	probably damaging	Het
Olfr935	A	T	9: 38,994,657	Y259*	probably null	Het
Pcdh12	C	A	18: 38,283,047	V342F	probably damaging	Het
Pcdhb4	T	A	18: 37,308,169	H177Q	possibly damaging	Het
Pcnx2	G	A	8: 125,886,951	A587V	probably benign	Het
Phkb	C	T	8: 86,043,789	P896S	probably damaging	Het
Prss36	A	G	7: 127,944,705	S165P	probably benign	Het
Prss43	A	G	9: 110,828,603	D190G	probably damaging	Het
Psmd14	T	C	2: 61,761,012	V53A	probably damaging	Het
Sel1l3	T	G	5: 53,116,362	H1054P	probably damaging	Het
Selenoh	T	C	2: 84,670,287	R70G	probably damaging	Het
Serpinb9d	A	G	13: 33,194,634	Q21R	probably benign	Het
Slc29a1	T	C	17: 45,588,362	E262G	probably benign	Het
Slc7a14	A	G	3: 31,224,235	L407P	probably damaging	Het
Smyd4	T	C	11: 75,390,499	V266A	possibly damaging	Het
Spata31d1a	T	A	13: 59,702,099	R738S	probably benign	Het
Srcin1	C	T	11: 97,551,889	G38S	probably damaging	Het
Stab2	A	T	10: 87,003,108		probably null	Het
Syde2	A	G	3: 146,020,276	N1308D	possibly damaging	Het
Trip11	A	T	12: 101,884,352	M1151K	probably damaging	Het
Zfp319	G	A	8: 95,331,843		probably benign	Het
Zfp518b	T	C	5: 38,674,564	N33D	probably benign	Het
Zfp874a	T	A	13: 67,443,296	I90F	probably benign	Het
Zmiz2	G	T	11: 6,399,593	V412L	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85
R9701:Ttll4	UTSW	1	74681323	missense	probably benign	0.07
R9802:Ttll4	UTSW	1	74681323	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AACGTATCTGTGTACCTCATACTC -3'
(R):5'- AAAGTCTAACCGTTCTCTGCTTTG -3'

Sequencing Primer
(F):5'- GTATCTGTGTACCTCATACTCCTTAC -3'
(R):5'- GTGCTAACTCCCTGGAATCCTAAG -3'

Posted On

2019-06-26