Incidental Mutation 'R7271:Slc7a14'
ID565279
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31224235 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 407 (L407P)
Ref Sequence ENSEMBL: ENSMUSP00000088803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably damaging
Transcript: ENSMUST00000091259
AA Change: L407P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: L407P

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: L407P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: L407P

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R8903:Slc7a14 UTSW 3 31223446 missense probably damaging 0.98
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCACTCACAGGAGAACAAGTTTC -3'
(R):5'- GAGTTAACCACAGCTCCCTG -3'

Sequencing Primer
(F):5'- GGAGAACAAGTTTCCTTCTCACAGTC -3'
(R):5'- GTTGCAGTTCTAACACACTGG -3'
Posted On2019-06-26