Incidental Mutation 'R7271:Manba'
ID 565280
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Name mannosidase, beta A, lysosomal
Synonyms B930014J03Rik, Bmn, 2410030O07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R7271 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135485611-135571404 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 135542376 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 342 (Y342F)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029814
AA Change: Y342F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: Y342F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131610
SMART Domains Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 22 163 1.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135554780 nonsense probably null
IGL01443:Manba APN 3 135544828 missense probably damaging 1.00
IGL01796:Manba APN 3 135542389 missense probably damaging 1.00
IGL02396:Manba APN 3 135544764 missense probably damaging 1.00
IGL02471:Manba APN 3 135507008 splice site probably benign
IGL02809:Manba APN 3 135547560 missense probably damaging 1.00
IGL02861:Manba APN 3 135570263 missense probably benign 0.03
IGL02934:Manba APN 3 135544749 missense probably benign 0.00
IGL03130:Manba APN 3 135551159 missense probably damaging 1.00
IGL03237:Manba APN 3 135544751 missense probably damaging 1.00
IGL03342:Manba APN 3 135517987 missense possibly damaging 0.51
R0551:Manba UTSW 3 135517973 missense probably damaging 0.98
R1549:Manba UTSW 3 135544806 missense probably damaging 1.00
R1752:Manba UTSW 3 135506945 missense probably damaging 1.00
R1932:Manba UTSW 3 135544740 missense probably benign 0.01
R1991:Manba UTSW 3 135551191 missense probably benign 0.05
R3729:Manba UTSW 3 135554850 missense probably benign 0.00
R3731:Manba UTSW 3 135554850 missense probably benign 0.00
R3813:Manba UTSW 3 135563262 missense possibly damaging 0.67
R4712:Manba UTSW 3 135544814 missense probably damaging 1.00
R5001:Manba UTSW 3 135567630 missense probably benign 0.00
R5481:Manba UTSW 3 135524556 missense possibly damaging 0.86
R5889:Manba UTSW 3 135524598 nonsense probably null
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6434:Manba UTSW 3 135511973 splice site probably null
R6760:Manba UTSW 3 135542451 missense probably damaging 0.98
R7164:Manba UTSW 3 135542388 missense probably damaging 1.00
R7182:Manba UTSW 3 135567513 missense probably benign 0.06
R7184:Manba UTSW 3 135523154 missense possibly damaging 0.62
R7212:Manba UTSW 3 135567635 missense probably benign
R7266:Manba UTSW 3 135517912 missense probably damaging 1.00
R7466:Manba UTSW 3 135542393 missense probably benign 0.13
R7467:Manba UTSW 3 135544801 missense probably damaging 1.00
R7542:Manba UTSW 3 135566593 missense probably benign 0.10
R7546:Manba UTSW 3 135570246 missense probably benign 0.01
R7726:Manba UTSW 3 135518009 missense probably benign 0.14
R8475:Manba UTSW 3 135511812 missense probably benign 0.13
R8768:Manba UTSW 3 135551234 missense probably damaging 1.00
R8856:Manba UTSW 3 135518003 missense probably damaging 0.98
R9140:Manba UTSW 3 135485729 missense probably benign
R9449:Manba UTSW 3 135549318 missense probably benign 0.01
Z1176:Manba UTSW 3 135563274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATGTACATATGGTGTGTTTGTACA -3'
(R):5'- CCAGTCCTTCTGCTGGGAT -3'

Sequencing Primer
(F):5'- GTTCTCGTGAGACAGAATCACTC -3'
(R):5'- ATACTCACCGATCGGAAG -3'
Posted On 2019-06-26