Incidental Mutation 'R7271:Zfp518b'
ID565285
Institutional Source Beutler Lab
Gene Symbol Zfp518b
Ensembl Gene ENSMUSG00000046572
Gene Namezinc finger protein 518B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38668484-38684826 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38674564 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 33 (N33D)
Ref Sequence ENSEMBL: ENSMUSP00000137381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057258] [ENSMUST00000178760] [ENSMUST00000179555] [ENSMUST00000180214]
Predicted Effect probably benign
Transcript: ENSMUST00000057258
AA Change: N33D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000061753
Gene: ENSMUSG00000046572
AA Change: N33D

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178760
Predicted Effect probably benign
Transcript: ENSMUST00000179555
AA Change: N33D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137381
Gene: ENSMUSG00000046572
AA Change: N33D

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
ZnF_C2H2 165 187 1.67e-2 SMART
ZnF_C2H2 193 216 1.16e-1 SMART
low complexity region 523 536 N/A INTRINSIC
low complexity region 636 645 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 1011 1023 N/A INTRINSIC
ZnF_C2H2 1044 1066 1.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180214
AA Change: N33D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000136948
Gene: ENSMUSG00000046572
AA Change: N33D

DomainStartEndE-ValueType
ZnF_C2H2 138 160 2.32e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Zfp518b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfp518b APN 5 38673766 missense possibly damaging 0.58
IGL01096:Zfp518b APN 5 38672788 missense probably benign 0.01
IGL02150:Zfp518b APN 5 38673343 missense probably damaging 1.00
IGL02150:Zfp518b APN 5 38673789 missense probably damaging 1.00
IGL02491:Zfp518b APN 5 38673780 missense possibly damaging 0.90
IGL02643:Zfp518b APN 5 38674155 missense probably damaging 1.00
IGL02710:Zfp518b APN 5 38672718 missense probably damaging 1.00
R0134:Zfp518b UTSW 5 38674659 start codon destroyed probably null 0.92
R0284:Zfp518b UTSW 5 38671740 missense probably damaging 1.00
R0308:Zfp518b UTSW 5 38672770 missense possibly damaging 0.64
R0421:Zfp518b UTSW 5 38674575 missense probably damaging 1.00
R0613:Zfp518b UTSW 5 38673603 missense probably damaging 1.00
R1604:Zfp518b UTSW 5 38673606 missense probably damaging 1.00
R1649:Zfp518b UTSW 5 38671881 missense probably damaging 1.00
R1845:Zfp518b UTSW 5 38671741 missense probably damaging 0.97
R1853:Zfp518b UTSW 5 38673407 missense probably benign 0.00
R2015:Zfp518b UTSW 5 38672002 missense probably benign 0.00
R2256:Zfp518b UTSW 5 38671636 missense possibly damaging 0.90
R3687:Zfp518b UTSW 5 38674112 missense probably damaging 1.00
R4275:Zfp518b UTSW 5 38671728 missense probably damaging 1.00
R4600:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4603:Zfp518b UTSW 5 38673627 missense probably damaging 0.98
R4739:Zfp518b UTSW 5 38674498 missense possibly damaging 0.89
R5519:Zfp518b UTSW 5 38674098 missense probably damaging 1.00
R6827:Zfp518b UTSW 5 38671539 missense probably damaging 1.00
R6982:Zfp518b UTSW 5 38672905 missense probably benign 0.00
R7263:Zfp518b UTSW 5 38672328 missense probably damaging 1.00
R7354:Zfp518b UTSW 5 38682779 start gained probably benign
R7554:Zfp518b UTSW 5 38673072 missense probably damaging 1.00
Z1088:Zfp518b UTSW 5 38674293 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACATAAGTGTCTTGGCTCTGC -3'
(R):5'- TGTGGCTCACATCTTCTTGTAAAAG -3'

Sequencing Primer
(F):5'- CCCAGGGCCTTTCCTCAAG -3'
(R):5'- AAGTGCCTGCTGCTCCAC -3'
Posted On2019-06-26