Incidental Mutation 'R7271:Ccng2'
ID565287
Institutional Source Beutler Lab
Gene Symbol Ccng2
Ensembl Gene ENSMUSG00000029385
Gene Namecyclin G2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location93267257-93276231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 93273343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 237 (S237R)
Ref Sequence ENSEMBL: ENSMUSP00000113278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031331] [ENSMUST00000121127]
Predicted Effect probably benign
Transcript: ENSMUST00000031331
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031331
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121127
AA Change: S237R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113278
Gene: ENSMUSG00000029385
AA Change: S237R

DomainStartEndE-ValueType
CYCLIN 61 147 3.06e-15 SMART
low complexity region 218 237 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153260
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Ccng2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Ccng2 APN 5 93270887 missense probably damaging 0.99
IGL01289:Ccng2 APN 5 93273417 missense probably null 0.88
R0133:Ccng2 UTSW 5 93273381 missense probably benign 0.15
R0266:Ccng2 UTSW 5 93271289 splice site probably benign
R0346:Ccng2 UTSW 5 93270894 missense probably damaging 1.00
R0401:Ccng2 UTSW 5 93273413 missense possibly damaging 0.52
R1087:Ccng2 UTSW 5 93273444 missense probably benign 0.17
R1373:Ccng2 UTSW 5 93271055 splice site probably benign
R1696:Ccng2 UTSW 5 93273382 missense possibly damaging 0.90
R3727:Ccng2 UTSW 5 93274951 missense probably damaging 1.00
R5395:Ccng2 UTSW 5 93269398 missense possibly damaging 0.84
R6337:Ccng2 UTSW 5 93270921 missense probably benign
R6611:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7077:Ccng2 UTSW 5 93269340 missense possibly damaging 0.91
R7140:Ccng2 UTSW 5 93268755 missense probably benign 0.00
R7161:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7193:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7233:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7235:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7269:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7270:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7449:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7451:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7567:Ccng2 UTSW 5 93270872 missense probably benign 0.01
R7614:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7657:Ccng2 UTSW 5 93273343 missense probably benign 0.00
R7658:Ccng2 UTSW 5 93273343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTACTAAACAGTGTACTTGGTTGG -3'
(R):5'- ATAGTGGGCAGCTCAGGAAC -3'

Sequencing Primer
(F):5'- GGAGTGTTATTTCAACCAGCAGTTCC -3'
(R):5'- CAGGAACACTGTAGTAGCTGCTG -3'
Posted On2019-06-26