Incidental Mutation 'R7271:Lrrc8c'
ID565288
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105607987 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 543 (S543G)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect probably benign
Transcript: ENSMUST00000067924
AA Change: S543G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: S543G

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R0815:Lrrc8c UTSW 5 105608534 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R7341:Lrrc8c UTSW 5 105607267 missense probably damaging 1.00
R7380:Lrrc8c UTSW 5 105607835 missense possibly damaging 0.71
R7630:Lrrc8c UTSW 5 105607702 missense probably damaging 0.99
R7789:Lrrc8c UTSW 5 105607200 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCCGTCAAGATCCAC -3'
(R):5'- ACTTGAGGTTGTTCTCCTTCAG -3'

Sequencing Primer
(F):5'- GTCAAGATCCACAGCGCCG -3'
(R):5'- AGGTTGTTCTCCTTCAGGTCCAG -3'
Posted On2019-06-26