Mutagenetix > Incidental Mutation

Incidental Mutation 'R7271:Atp4a'

565290

Institutional Source

Beutler Lab

Gene Symbol

Atp4a

Ensembl Gene

ENSMUSG00000005553

Gene Name

ATPase, H+/K+ exchanging, gastric, alpha polypeptide

Synonyms

H+/K+-ATPase alpha, H+K+-transporting alpha 1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R7271 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30712209-30725534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30722519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamine at position 827 (K827Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005692
AA Change: K836Q

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: K836Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	5.4e-23	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	144	375	1.1e-57	PFAM
Pfam:Hydrolase	380	739	5.3e-16	PFAM
Pfam:HAD	383	736	1.9e-18	PFAM
Pfam:Cation_ATPase	436	531	1.6e-24	PFAM
Pfam:Cation_ATPase_C	809	1019	4.8e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170371
AA Change: K827Q

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: K827Q

Domain	Start	End	E-Value	Type
Pfam:H-K_ATPase_N	2	42	4.9e-28	PFAM
Cation_ATPase_N	52	126	2.26e-18	SMART
Pfam:E1-E2_ATPase	145	376	1e-62	PFAM
Pfam:Hydrolase	380	730	9.3e-25	PFAM
Pfam:HAD	383	727	2.1e-15	PFAM
Pfam:Hydrolase_like2	436	531	4e-25	PFAM
Pfam:Cation_ATPase_C	800	1010	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171014

Meta Mutation Damage Score

0.0778

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	A	2: 118,760,683		probably null	Het
Afg1l	C	T	10: 42,415,548		probably null	Het
Ahnak2	A	T	12: 112,780,802	V70E		Het
Alpk3	A	G	7: 81,078,454	E444G	possibly damaging	Het
Amer2	T	A	14: 60,379,674	D439E	possibly damaging	Het
Ano6	A	G	15: 95,913,900	Y222C	probably damaging	Het
Atp9a	G	A	2: 168,734,127			Het
Casp7	T	A	19: 56,436,361	C171S	probably damaging	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdkl1	A	G	12: 69,748,811	L315S	probably benign	Het
Crybg1	G	T	10: 43,997,623	S1163*	probably null	Het
Csmd1	A	T	8: 17,027,279	W121R	probably damaging	Het
Cyyr1	A	T	16: 85,465,605	M88K	possibly damaging	Het
Dlc1	T	C	8: 36,582,800	Q587R	probably damaging	Het
Dock2	T	C	11: 34,273,750	E1128G	possibly damaging	Het
Dynap	T	A	18: 70,241,249	T69S	possibly damaging	Het
Esr1	T	C	10: 4,783,874	C225R	probably damaging	Het
Fbxo31	C	T	8: 121,578,764		probably benign	Het
Fndc11	G	A	2: 181,222,100	V233I	possibly damaging	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gm10471	G	A	5: 26,087,995	T67I	probably benign	Het
Gtf2ird1	A	G	5: 134,404,904	L223P	probably benign	Het
Ifi214	A	T	1: 173,529,476	H20Q	probably damaging	Het
Impa2	T	A	18: 67,306,736	I101N	probably damaging	Het
Kidins220	A	T	12: 25,011,571	T854S	probably benign	Het
Lamb1	T	A	12: 31,287,424	C385S	probably damaging	Het
Lrrc8c	A	G	5: 105,607,987	S543G	probably benign	Het
Maats1	A	G	16: 38,328,346	I240T	probably damaging	Het
Manba	A	T	3: 135,542,376	Y342F	probably damaging	Het
Map3k1	T	C	13: 111,756,697	D758G	probably benign	Het
Mtor	G	T	4: 148,546,485	A2300S	possibly damaging	Het
Musk	T	A	4: 58,373,409	M793K	probably damaging	Het
Nup133	A	C	8: 123,922,414	I563S	probably benign	Het
Olfr1117-ps1	T	A	2: 87,284,381	N30K	probably benign	Het
Olfr1283	A	G	2: 111,369,348	T239A	probably damaging	Het
Olfr479	G	A	7: 108,055,216	R78Q	probably damaging	Het
Olfr935	A	T	9: 38,994,657	Y259*	probably null	Het
Pcdh12	C	A	18: 38,283,047	V342F	probably damaging	Het
Pcdhb4	T	A	18: 37,308,169	H177Q	possibly damaging	Het
Pcnx2	G	A	8: 125,886,951	A587V	probably benign	Het
Phkb	C	T	8: 86,043,789	P896S	probably damaging	Het
Prss36	A	G	7: 127,944,705	S165P	probably benign	Het
Prss43	A	G	9: 110,828,603	D190G	probably damaging	Het
Psmd14	T	C	2: 61,761,012	V53A	probably damaging	Het
Sel1l3	T	G	5: 53,116,362	H1054P	probably damaging	Het
Selenoh	T	C	2: 84,670,287	R70G	probably damaging	Het
Serpinb9d	A	G	13: 33,194,634	Q21R	probably benign	Het
Slc29a1	T	C	17: 45,588,362	E262G	probably benign	Het
Slc7a14	A	G	3: 31,224,235	L407P	probably damaging	Het
Smyd4	T	C	11: 75,390,499	V266A	possibly damaging	Het
Spata31d1a	T	A	13: 59,702,099	R738S	probably benign	Het
Srcin1	C	T	11: 97,551,889	G38S	probably damaging	Het
Stab2	A	T	10: 87,003,108		probably null	Het
Syde2	A	G	3: 146,020,276	N1308D	possibly damaging	Het
Trip11	A	T	12: 101,884,352	M1151K	probably damaging	Het
Ttll4	A	T	1: 74,688,661	I861F	possibly damaging	Het
Zfp319	G	A	8: 95,331,843		probably benign	Het
Zfp518b	T	C	5: 38,674,564	N33D	probably benign	Het
Zfp874a	T	A	13: 67,443,296	I90F	probably benign	Het
Zmiz2	G	T	11: 6,399,593	V412L	probably damaging	Het

Other mutations in Atp4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Atp4a	APN	7	30713204	missense	possibly damaging	0.95
IGL01327:Atp4a	APN	7	30713250	missense	possibly damaging	0.96
IGL01510:Atp4a	APN	7	30720791	missense	probably benign	0.02
IGL01763:Atp4a	APN	7	30715518	missense	probably benign	0.20
IGL02061:Atp4a	APN	7	30715029	missense	probably damaging	1.00
IGL02435:Atp4a	APN	7	30717057	missense	probably benign
IGL02903:Atp4a	APN	7	30715919	missense	probably benign	0.00
IGL03181:Atp4a	APN	7	30724704	missense	probably benign	0.02
IGL03350:Atp4a	APN	7	30720867	missense	probably damaging	1.00
atypical	UTSW	7	30715356	missense	possibly damaging	0.84
sublytic	UTSW	7	30715800	missense	probably benign	0.32
IGL03097:Atp4a	UTSW	7	30723037	missense	probably benign	0.14
R0095:Atp4a	UTSW	7	30720735	missense	probably damaging	0.99
R0121:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0140:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0241:Atp4a	UTSW	7	30717135	missense	probably benign	0.00
R0437:Atp4a	UTSW	7	30720101	missense	probably benign	0.00
R0624:Atp4a	UTSW	7	30718999	missense	probably benign
R1164:Atp4a	UTSW	7	30717692	missense	probably benign	0.00
R2105:Atp4a	UTSW	7	30720368	critical splice donor site	probably null
R2272:Atp4a	UTSW	7	30715500	nonsense	probably null
R2327:Atp4a	UTSW	7	30720241	missense	probably benign	0.16
R2881:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2990:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2992:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R2993:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3123:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3125:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3441:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3442:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3686:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3687:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R3845:Atp4a	UTSW	7	30717115	missense	probably null	0.99
R4027:Atp4a	UTSW	7	30724952	splice site	probably null
R4072:Atp4a	UTSW	7	30715332	missense	probably benign	0.09
R4433:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4454:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4457:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4458:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4510:Atp4a	UTSW	7	30724253	nonsense	probably null
R4511:Atp4a	UTSW	7	30724253	nonsense	probably null
R4576:Atp4a	UTSW	7	30717722	missense	probably benign	0.25
R4656:Atp4a	UTSW	7	30719948	intron	probably benign
R4661:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4662:Atp4a	UTSW	7	30720225	missense	probably benign	0.16
R4852:Atp4a	UTSW	7	30724268	missense	probably benign	0.10
R4892:Atp4a	UTSW	7	30712474	missense	probably benign	0.07
R4907:Atp4a	UTSW	7	30719092	missense	possibly damaging	0.66
R5024:Atp4a	UTSW	7	30715864	missense	possibly damaging	0.82
R5254:Atp4a	UTSW	7	30715530	missense	probably damaging	1.00
R5318:Atp4a	UTSW	7	30715329	missense	probably damaging	1.00
R5340:Atp4a	UTSW	7	30720806	missense	probably benign
R5484:Atp4a	UTSW	7	30720672	unclassified	probably benign
R5729:Atp4a	UTSW	7	30712426	missense	possibly damaging	0.48
R5762:Atp4a	UTSW	7	30719096	missense	probably damaging	0.99
R5797:Atp4a	UTSW	7	30712649	missense	probably damaging	1.00
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6030:Atp4a	UTSW	7	30722516	missense	probably damaging	0.99
R6077:Atp4a	UTSW	7	30715919	missense	probably benign	0.00
R6243:Atp4a	UTSW	7	30715957	missense	possibly damaging	0.68
R6346:Atp4a	UTSW	7	30715356	missense	possibly damaging	0.84
R6459:Atp4a	UTSW	7	30712462	missense	probably benign	0.00
R6515:Atp4a	UTSW	7	30712478	missense	possibly damaging	0.78
R6773:Atp4a	UTSW	7	30715377	missense	probably damaging	0.98
R6854:Atp4a	UTSW	7	30715008	missense	probably benign	0.29
R7215:Atp4a	UTSW	7	30717360	missense	possibly damaging	0.61
R7340:Atp4a	UTSW	7	30716730	missense	possibly damaging	0.94
R7457:Atp4a	UTSW	7	30720767	missense	probably benign	0.08
R7593:Atp4a	UTSW	7	30724680	missense	probably benign	0.08
R7712:Atp4a	UTSW	7	30715553	missense	probably damaging	0.96
R7762:Atp4a	UTSW	7	30720036	missense	probably damaging	0.96
R8714:Atp4a	UTSW	7	30720588	missense	probably damaging	0.99
R9324:Atp4a	UTSW	7	30715782	missense	probably benign	0.02
Z1177:Atp4a	UTSW	7	30717840	missense	possibly damaging	0.47
Z1186:Atp4a	UTSW	7	30717357	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATACAGCCTGCACACATGGG -3'
(R):5'- ATACTCAGGGACATGCAGCC -3'

Sequencing Primer
(F):5'- TGCACACATGGGTCAAGC -3'
(R):5'- GACATGCAGCCGCCAAG -3'

Posted On

2019-06-26