Incidental Mutation 'R7271:Fto'
ID565297
Institutional Source Beutler Lab
Gene Symbol Fto
Ensembl Gene ENSMUSG00000055932
Gene Namefat mass and obesity associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location91313525-91668439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91485190 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 381 (F381S)
Ref Sequence ENSEMBL: ENSMUSP00000068380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069718] [ENSMUST00000128081] [ENSMUST00000136802]
Predicted Effect probably damaging
Transcript: ENSMUST00000069718
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068380
Gene: ENSMUSG00000055932
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
FTO_NTD 35 323 2.71e-191 SMART
Pfam:FTO_CTD 326 495 1.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128081
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000136802
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted knock-out allele exhibit decreased body weight, adipose tissue, and body fat and increased metabolism, serum lipids, and serum glucagon that may be gender and diet dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Fto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Fto APN 8 91441716 missense probably benign 0.29
IGL01541:Fto APN 8 91409748 missense probably damaging 1.00
IGL01636:Fto APN 8 91409341 missense probably damaging 1.00
IGL01788:Fto APN 8 91409731 missense probably benign 0.25
IGL02016:Fto APN 8 91666406 nonsense probably null
IGL02365:Fto APN 8 91468375 missense probably damaging 1.00
IGL02639:Fto APN 8 91409528 missense probably damaging 1.00
IGL02926:Fto APN 8 91485167 missense probably damaging 1.00
IGL03194:Fto APN 8 91409787 missense probably damaging 1.00
R0091:Fto UTSW 8 91441807 critical splice donor site probably null
R0105:Fto UTSW 8 91522802 missense probably damaging 1.00
R0326:Fto UTSW 8 91409527 missense probably damaging 1.00
R0332:Fto UTSW 8 91401890 splice site probably benign
R0378:Fto UTSW 8 91474312 missense probably damaging 1.00
R0601:Fto UTSW 8 91401802 splice site probably null
R1526:Fto UTSW 8 91441686 missense possibly damaging 0.90
R2092:Fto UTSW 8 91409687 nonsense probably null
R4731:Fto UTSW 8 91409714 missense probably damaging 1.00
R4732:Fto UTSW 8 91409714 missense probably damaging 1.00
R4733:Fto UTSW 8 91409714 missense probably damaging 1.00
R5347:Fto UTSW 8 91391479 intron probably benign
R5840:Fto UTSW 8 91666440 utr 3 prime probably benign
R7213:Fto UTSW 8 91391507 missense probably benign 0.00
R7658:Fto UTSW 8 91666322 missense probably benign 0.34
R7763:Fto UTSW 8 91409443 missense probably damaging 0.99
R8110:Fto UTSW 8 91485190 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAAGCTTTTCTCGCC -3'
(R):5'- AAACAGAATTGCAGGCTGCTC -3'

Sequencing Primer
(F):5'- AAGCTTTTCTCGCCTGCCTC -3'
(R):5'- TGGACGACGTATACATTTGCC -3'
Posted On2019-06-26