Incidental Mutation 'R7271:Prss43'
ID565303
Institutional Source Beutler Lab
Gene Symbol Prss43
Ensembl Gene ENSMUSG00000058398
Gene Nameprotease, serine 43
SynonymsLOC272643, Tessp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110826690-110831839 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110828603 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 190 (D190G)
Ref Sequence ENSEMBL: ENSMUSP00000076752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077549] [ENSMUST00000141089]
Predicted Effect probably damaging
Transcript: ENSMUST00000077549
AA Change: D190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076752
Gene: ENSMUSG00000058398
AA Change: D190G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
Tryp_SPc 115 350 5.86e-58 SMART
transmembrane domain 362 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141089
SMART Domains Protein: ENSMUSP00000117039
Gene: ENSMUSG00000032493

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Trypsin 112 144 1.3e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Prss43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Prss43 APN 9 110829470 missense probably benign 0.02
IGL01636:Prss43 APN 9 110827437 missense possibly damaging 0.75
IGL03046:Prss43 UTSW 9 110830981 missense probably benign 0.01
PIT4576001:Prss43 UTSW 9 110827887 missense probably damaging 1.00
R0020:Prss43 UTSW 9 110828512 unclassified probably benign
R0278:Prss43 UTSW 9 110827362 missense probably benign 0.07
R0883:Prss43 UTSW 9 110829508 missense probably damaging 1.00
R1384:Prss43 UTSW 9 110827442 missense probably benign 0.10
R2212:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3412:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3808:Prss43 UTSW 9 110827772 missense probably damaging 1.00
R4202:Prss43 UTSW 9 110827461 missense probably benign 0.08
R4530:Prss43 UTSW 9 110829504 missense probably benign 0.38
R4752:Prss43 UTSW 9 110827768 missense possibly damaging 0.47
R5009:Prss43 UTSW 9 110827421 missense possibly damaging 0.50
R6920:Prss43 UTSW 9 110828612 missense probably benign 0.04
R7406:Prss43 UTSW 9 110828696 missense probably damaging 1.00
R7758:Prss43 UTSW 9 110829391 missense possibly damaging 0.91
R8257:Prss43 UTSW 9 110830812 missense possibly damaging 0.95
R8686:Prss43 UTSW 9 110829426 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAGGAACCACACTTGCTGGG -3'
(R):5'- ACCAATTTCGTTCTGTTGGC -3'

Sequencing Primer
(F):5'- ACACTTGCTGGGAGGCATG -3'
(R):5'- AATTTCGTTCTGTTGGCCCCAG -3'
Posted On2019-06-26