Incidental Mutation 'R7271:Afg1l'
ID565305
Institutional Source Beutler Lab
Gene Symbol Afg1l
Ensembl Gene ENSMUSG00000038302
Gene NameAFG1 like ATPase
SynonymsLace1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location42312585-42478565 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 42415548 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041024] [ENSMUST00000133326]
Predicted Effect probably null
Transcript: ENSMUST00000041024
SMART Domains Protein: ENSMUSP00000036149
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 74 432 4.4e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133326
SMART Domains Protein: ENSMUSP00000123510
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
Pfam:AFG1_ATPase 73 272 2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149832
SMART Domains Protein: ENSMUSP00000119620
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 2 80 5.3e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151747
SMART Domains Protein: ENSMUSP00000120389
Gene: ENSMUSG00000038302

DomainStartEndE-ValueType
Pfam:AFG1_ATPase 5 300 2e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial integral membrane protein that plays a role in mitochondrial protein homeostasis. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. It functions to mediate the degradation of nuclear-encoded complex IV subunits. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. Polymorphisms in this gene have been associated with bipolar disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Afg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Afg1l APN 10 42339911 missense possibly damaging 0.86
IGL02041:Afg1l APN 10 42454380 missense probably damaging 0.98
IGL02309:Afg1l APN 10 42454378 missense possibly damaging 0.90
IGL02323:Afg1l APN 10 42454510 nonsense probably null
IGL03088:Afg1l APN 10 42426497 missense probably damaging 1.00
PIT4458001:Afg1l UTSW 10 42454370 nonsense probably null
R0969:Afg1l UTSW 10 42318621 missense probably damaging 1.00
R1665:Afg1l UTSW 10 42426577 missense probably damaging 1.00
R1703:Afg1l UTSW 10 42400399 missense probably damaging 1.00
R1766:Afg1l UTSW 10 42454495 missense probably benign 0.00
R2941:Afg1l UTSW 10 42478295 unclassified probably null
R4846:Afg1l UTSW 10 42454494 missense probably benign 0.02
R4887:Afg1l UTSW 10 42454378 missense probably benign 0.00
R5668:Afg1l UTSW 10 42360240 missense probably damaging 1.00
R5934:Afg1l UTSW 10 42318686 missense probably damaging 1.00
R6575:Afg1l UTSW 10 42318716 missense probably damaging 1.00
R6972:Afg1l UTSW 10 42478374 missense probably benign 0.00
R7270:Afg1l UTSW 10 42425249 missense probably damaging 1.00
R7577:Afg1l UTSW 10 42318611 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACTAGGCTCAGCTTGC -3'
(R):5'- ACTGTTCGATGGCCTTTCATGC -3'

Sequencing Primer
(F):5'- TTCAGATTGAGCCTGGTC -3'
(R):5'- GATGGCCTTTCATGCTTTTAATTATC -3'
Posted On2019-06-26