Incidental Mutation 'R7271:Cdkl1'
ID 565313
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Name cyclin dependent kinase like 1
Synonyms 4933411O17Rik
MMRRC Submission 045356-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R7271 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 69793622-69838041 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69795585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 315 (L315S)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000021377] [ENSMUST00000220916]
AlphaFold Q8CEQ0
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000021377
AA Change: L315S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: L315S

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l C T 10: 42,291,544 (GRCm39) probably null Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
Alpk3 A G 7: 80,728,202 (GRCm39) E444G possibly damaging Het
Amer2 T A 14: 60,617,123 (GRCm39) D439E possibly damaging Het
Ano6 A G 15: 95,811,781 (GRCm39) Y222C probably damaging Het
Atp4a A C 7: 30,421,944 (GRCm39) K827Q probably benign Het
Atp9a G A 2: 168,576,047 (GRCm39) Het
Casp7 T A 19: 56,424,793 (GRCm39) C171S probably damaging Het
Ccdc9b T A 2: 118,591,164 (GRCm39) probably null Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cfap91 A G 16: 38,148,708 (GRCm39) I240T probably damaging Het
Crybg1 G T 10: 43,873,619 (GRCm39) S1163* probably null Het
Csmd1 A T 8: 17,077,295 (GRCm39) W121R probably damaging Het
Cyyr1 A T 16: 85,262,493 (GRCm39) M88K possibly damaging Het
Dlc1 T C 8: 37,049,954 (GRCm39) Q587R probably damaging Het
Dock2 T C 11: 34,223,750 (GRCm39) E1128G possibly damaging Het
Dynap T A 18: 70,374,320 (GRCm39) T69S possibly damaging Het
Esr1 T C 10: 4,733,874 (GRCm39) C225R probably damaging Het
Fbxo31 C T 8: 122,305,503 (GRCm39) probably benign Het
Fndc11 G A 2: 180,863,893 (GRCm39) V233I possibly damaging Het
Fto T C 8: 92,211,818 (GRCm39) F381S probably damaging Het
Gtf2ird1 A G 5: 134,433,758 (GRCm39) L223P probably benign Het
Ifi214 A T 1: 173,357,042 (GRCm39) H20Q probably damaging Het
Impa2 T A 18: 67,439,806 (GRCm39) I101N probably damaging Het
Kidins220 A T 12: 25,061,570 (GRCm39) T854S probably benign Het
Lamb1 T A 12: 31,337,423 (GRCm39) C385S probably damaging Het
Lrrc8c A G 5: 105,755,853 (GRCm39) S543G probably benign Het
Manba A T 3: 135,248,137 (GRCm39) Y342F probably damaging Het
Map3k1 T C 13: 111,893,231 (GRCm39) D758G probably benign Het
Mtor G T 4: 148,630,942 (GRCm39) A2300S possibly damaging Het
Musk T A 4: 58,373,409 (GRCm39) M793K probably damaging Het
Nup133 A C 8: 124,649,153 (GRCm39) I563S probably benign Het
Or10ab4 G A 7: 107,654,423 (GRCm39) R78Q probably damaging Het
Or10ag55-ps1 T A 2: 87,114,725 (GRCm39) N30K probably benign Het
Or4k77 A G 2: 111,199,693 (GRCm39) T239A probably damaging Het
Or8g21 A T 9: 38,905,953 (GRCm39) Y259* probably null Het
Pcdh12 C A 18: 38,416,100 (GRCm39) V342F probably damaging Het
Pcdhb4 T A 18: 37,441,222 (GRCm39) H177Q possibly damaging Het
Pcnx2 G A 8: 126,613,690 (GRCm39) A587V probably benign Het
Phkb C T 8: 86,770,418 (GRCm39) P896S probably damaging Het
Prss36 A G 7: 127,543,877 (GRCm39) S165P probably benign Het
Prss43 A G 9: 110,657,671 (GRCm39) D190G probably damaging Het
Psmd14 T C 2: 61,591,356 (GRCm39) V53A probably damaging Het
Sel1l3 T G 5: 53,273,704 (GRCm39) H1054P probably damaging Het
Selenoh T C 2: 84,500,631 (GRCm39) R70G probably damaging Het
Serpinb9d A G 13: 33,378,617 (GRCm39) Q21R probably benign Het
Slc29a1 T C 17: 45,899,288 (GRCm39) E262G probably benign Het
Slc7a14 A G 3: 31,278,384 (GRCm39) L407P probably damaging Het
Smyd4 T C 11: 75,281,325 (GRCm39) V266A possibly damaging Het
Spata31d1a T A 13: 59,849,913 (GRCm39) R738S probably benign Het
Speer4a2 G A 5: 26,292,993 (GRCm39) T67I probably benign Het
Srcin1 C T 11: 97,442,715 (GRCm39) G38S probably damaging Het
Stab2 A T 10: 86,838,972 (GRCm39) probably null Het
Syde2 A G 3: 145,726,031 (GRCm39) N1308D possibly damaging Het
Trip11 A T 12: 101,850,611 (GRCm39) M1151K probably damaging Het
Ttll4 A T 1: 74,727,820 (GRCm39) I861F possibly damaging Het
Zfp319 G A 8: 96,058,471 (GRCm39) probably benign Het
Zfp518b T C 5: 38,831,907 (GRCm39) N33D probably benign Het
Zfp874a T A 13: 67,591,415 (GRCm39) I90F probably benign Het
Zmiz2 G T 11: 6,349,593 (GRCm39) V412L probably damaging Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69,797,514 (GRCm39) missense probably benign
IGL01859:Cdkl1 APN 12 69,806,903 (GRCm39) missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69,836,809 (GRCm39) missense probably benign 0.01
R0905:Cdkl1 UTSW 12 69,803,338 (GRCm39) nonsense probably null
R3922:Cdkl1 UTSW 12 69,803,373 (GRCm39) missense probably damaging 1.00
R3924:Cdkl1 UTSW 12 69,803,373 (GRCm39) missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69,803,373 (GRCm39) missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69,804,014 (GRCm39) missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69,803,338 (GRCm39) nonsense probably null
R7183:Cdkl1 UTSW 12 69,795,706 (GRCm39) missense probably damaging 1.00
R7461:Cdkl1 UTSW 12 69,803,235 (GRCm39) missense probably benign 0.24
R8342:Cdkl1 UTSW 12 69,800,952 (GRCm39) missense probably damaging 1.00
R8357:Cdkl1 UTSW 12 69,794,112 (GRCm39) missense probably benign 0.01
R8457:Cdkl1 UTSW 12 69,794,112 (GRCm39) missense probably benign 0.01
R8827:Cdkl1 UTSW 12 69,794,123 (GRCm39) missense probably benign 0.00
R9177:Cdkl1 UTSW 12 69,794,100 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGGCCCTGGTTGATAATTC -3'
(R):5'- AGTGTTCAGTCTTTCAAAGAAGTCG -3'

Sequencing Primer
(F):5'- GCCCTGGTTGATAATTCAGATGACC -3'
(R):5'- CATCTTCAAAGGTGTAAAGGGGTTC -3'
Posted On 2019-06-26