Incidental Mutation 'R7271:Cdkl1'
ID565313
Institutional Source Beutler Lab
Gene Symbol Cdkl1
Ensembl Gene ENSMUSG00000020990
Gene Namecyclin-dependent kinase-like 1 (CDC2-related kinase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69746848-69791267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69748811 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 315 (L315S)
Ref Sequence ENSEMBL: ENSMUSP00000021377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021372] [ENSMUST00000021377] [ENSMUST00000220916]
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000021377
AA Change: L315S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021377
Gene: ENSMUSG00000020990
AA Change: L315S

DomainStartEndE-ValueType
S_TKc 4 287 5.27e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a large family of CDC2-related serine/threonine protein kinases. It accumulates primarily in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Maats1 A G 16: 38,328,346 I240T probably damaging Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Cdkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Cdkl1 APN 12 69750740 missense probably benign
IGL01859:Cdkl1 APN 12 69760129 missense probably damaging 1.00
R0218:Cdkl1 UTSW 12 69790035 missense probably benign 0.01
R0905:Cdkl1 UTSW 12 69756564 nonsense probably null
R3922:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3924:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R3925:Cdkl1 UTSW 12 69756599 missense probably damaging 1.00
R5050:Cdkl1 UTSW 12 69757240 missense probably damaging 1.00
R5851:Cdkl1 UTSW 12 69756564 nonsense probably null
R7183:Cdkl1 UTSW 12 69748932 missense probably damaging 1.00
R7461:Cdkl1 UTSW 12 69756461 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGAGGCCCTGGTTGATAATTC -3'
(R):5'- AGTGTTCAGTCTTTCAAAGAAGTCG -3'

Sequencing Primer
(F):5'- GCCCTGGTTGATAATTCAGATGACC -3'
(R):5'- CATCTTCAAAGGTGTAAAGGGGTTC -3'
Posted On2019-06-26