Incidental Mutation 'R7271:Maats1'
ID565322
Institutional Source Beutler Lab
Gene Symbol Maats1
Ensembl Gene ENSMUSG00000022805
Gene NameMYCBP-associated, testis expressed 1
SynonymsSpata26, 4932425I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7271 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38297754-38342143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38328346 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 240 (I240T)
Ref Sequence ENSEMBL: ENSMUSP00000023501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023501] [ENSMUST00000114740]
Predicted Effect probably damaging
Transcript: ENSMUST00000023501
AA Change: I240T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: I240T

DomainStartEndE-ValueType
Pfam:PaaSYMP 190 342 1.4e-65 PFAM
low complexity region 413 428 N/A INTRINSIC
low complexity region 513 526 N/A INTRINSIC
low complexity region 599 613 N/A INTRINSIC
coiled coil region 650 682 N/A INTRINSIC
coiled coil region 737 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114740
AA Change: I240T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110388
Gene: ENSMUSG00000022805
AA Change: I240T

DomainStartEndE-ValueType
Pfam:PaaSYMP 189 342 1.3e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T A 2: 118,760,683 probably null Het
Afg1l C T 10: 42,415,548 probably null Het
Ahnak2 A T 12: 112,780,802 V70E Het
Alpk3 A G 7: 81,078,454 E444G possibly damaging Het
Amer2 T A 14: 60,379,674 D439E possibly damaging Het
Ano6 A G 15: 95,913,900 Y222C probably damaging Het
Atp4a A C 7: 30,722,519 K827Q probably benign Het
Atp9a G A 2: 168,734,127 Het
Casp7 T A 19: 56,436,361 C171S probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdkl1 A G 12: 69,748,811 L315S probably benign Het
Crybg1 G T 10: 43,997,623 S1163* probably null Het
Csmd1 A T 8: 17,027,279 W121R probably damaging Het
Cyyr1 A T 16: 85,465,605 M88K possibly damaging Het
Dlc1 T C 8: 36,582,800 Q587R probably damaging Het
Dock2 T C 11: 34,273,750 E1128G possibly damaging Het
Dynap T A 18: 70,241,249 T69S possibly damaging Het
Esr1 T C 10: 4,783,874 C225R probably damaging Het
Fbxo31 C T 8: 121,578,764 probably benign Het
Fndc11 G A 2: 181,222,100 V233I possibly damaging Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gm10471 G A 5: 26,087,995 T67I probably benign Het
Gtf2ird1 A G 5: 134,404,904 L223P probably benign Het
Ifi214 A T 1: 173,529,476 H20Q probably damaging Het
Impa2 T A 18: 67,306,736 I101N probably damaging Het
Kidins220 A T 12: 25,011,571 T854S probably benign Het
Lamb1 T A 12: 31,287,424 C385S probably damaging Het
Lrrc8c A G 5: 105,607,987 S543G probably benign Het
Manba A T 3: 135,542,376 Y342F probably damaging Het
Map3k1 T C 13: 111,756,697 D758G probably benign Het
Mtor G T 4: 148,546,485 A2300S possibly damaging Het
Musk T A 4: 58,373,409 M793K probably damaging Het
Nup133 A C 8: 123,922,414 I563S probably benign Het
Olfr1117-ps1 T A 2: 87,284,381 N30K probably benign Het
Olfr1283 A G 2: 111,369,348 T239A probably damaging Het
Olfr479 G A 7: 108,055,216 R78Q probably damaging Het
Olfr935 A T 9: 38,994,657 Y259* probably null Het
Pcdh12 C A 18: 38,283,047 V342F probably damaging Het
Pcdhb4 T A 18: 37,308,169 H177Q possibly damaging Het
Pcnx2 G A 8: 125,886,951 A587V probably benign Het
Phkb C T 8: 86,043,789 P896S probably damaging Het
Prss36 A G 7: 127,944,705 S165P probably benign Het
Prss43 A G 9: 110,828,603 D190G probably damaging Het
Psmd14 T C 2: 61,761,012 V53A probably damaging Het
Sel1l3 T G 5: 53,116,362 H1054P probably damaging Het
Selenoh T C 2: 84,670,287 R70G probably damaging Het
Serpinb9d A G 13: 33,194,634 Q21R probably benign Het
Slc29a1 T C 17: 45,588,362 E262G probably benign Het
Slc7a14 A G 3: 31,224,235 L407P probably damaging Het
Smyd4 T C 11: 75,390,499 V266A possibly damaging Het
Spata31d1a T A 13: 59,702,099 R738S probably benign Het
Srcin1 C T 11: 97,551,889 G38S probably damaging Het
Stab2 A T 10: 87,003,108 probably null Het
Syde2 A G 3: 146,020,276 N1308D possibly damaging Het
Trip11 A T 12: 101,884,352 M1151K probably damaging Het
Ttll4 A T 1: 74,688,661 I861F possibly damaging Het
Zfp319 G A 8: 95,331,843 probably benign Het
Zfp518b T C 5: 38,674,564 N33D probably benign Het
Zfp874a T A 13: 67,443,296 I90F probably benign Het
Zmiz2 G T 11: 6,399,593 V412L probably damaging Het
Other mutations in Maats1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Maats1 APN 16 38336342 critical splice donor site probably null
IGL02243:Maats1 APN 16 38341780 utr 5 prime probably benign
IGL02377:Maats1 APN 16 38332819 splice site probably benign
IGL02604:Maats1 APN 16 38321559 unclassified probably benign
IGL02623:Maats1 APN 16 38333778 missense possibly damaging 0.51
IGL02985:Maats1 APN 16 38298272 missense probably damaging 0.98
IGL03389:Maats1 APN 16 38324136 critical splice donor site probably null
PIT4280001:Maats1 UTSW 16 38332773 missense probably benign 0.23
PIT4449001:Maats1 UTSW 16 38328358 missense probably damaging 1.00
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0076:Maats1 UTSW 16 38302684 nonsense probably null
R0360:Maats1 UTSW 16 38298297 critical splice acceptor site probably null
R0501:Maats1 UTSW 16 38335635 missense probably damaging 1.00
R0523:Maats1 UTSW 16 38328374 missense probably damaging 1.00
R0743:Maats1 UTSW 16 38335634 missense possibly damaging 0.48
R0900:Maats1 UTSW 16 38336402 missense possibly damaging 0.70
R1218:Maats1 UTSW 16 38298133 missense probably benign
R1499:Maats1 UTSW 16 38321400 missense probably damaging 0.96
R1693:Maats1 UTSW 16 38341723 missense probably benign
R1793:Maats1 UTSW 16 38321419 missense possibly damaging 0.77
R1854:Maats1 UTSW 16 38324297 splice site probably null
R2007:Maats1 UTSW 16 38298254 missense probably benign 0.02
R2126:Maats1 UTSW 16 38341762 missense probably benign 0.19
R2443:Maats1 UTSW 16 38302732 missense probably damaging 1.00
R2857:Maats1 UTSW 16 38302713 missense probably damaging 1.00
R2937:Maats1 UTSW 16 38311038 missense possibly damaging 0.65
R3441:Maats1 UTSW 16 38333806 missense probably benign 0.03
R3442:Maats1 UTSW 16 38333806 missense probably benign 0.03
R4056:Maats1 UTSW 16 38298214 missense probably benign
R4057:Maats1 UTSW 16 38298214 missense probably benign
R4424:Maats1 UTSW 16 38320365 missense probably damaging 1.00
R4493:Maats1 UTSW 16 38341768 missense probably benign 0.00
R4546:Maats1 UTSW 16 38335523 missense probably benign 0.11
R5177:Maats1 UTSW 16 38332321 missense probably benign 0.00
R5496:Maats1 UTSW 16 38321493 missense probably damaging 1.00
R5868:Maats1 UTSW 16 38332242 missense probably damaging 1.00
R5944:Maats1 UTSW 16 38328310 missense probably damaging 0.97
R6165:Maats1 UTSW 16 38333811 missense possibly damaging 0.93
R6521:Maats1 UTSW 16 38306759 missense probably benign 0.06
R6804:Maats1 UTSW 16 38332242 missense probably damaging 0.97
R7086:Maats1 UTSW 16 38306857 missense possibly damaging 0.70
R7202:Maats1 UTSW 16 38335597 missense probably benign 0.00
R7325:Maats1 UTSW 16 38321601 intron probably null
R7375:Maats1 UTSW 16 38335618 missense probably damaging 0.97
R7453:Maats1 UTSW 16 38321479 missense possibly damaging 0.51
R7604:Maats1 UTSW 16 38298236 nonsense probably null
X0062:Maats1 UTSW 16 38298099 missense possibly damaging 0.70
X0067:Maats1 UTSW 16 38306860 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AACGTGTGTACACCCATGAG -3'
(R):5'- CTAAAACAATGTCTGCCTCAGTAAGAG -3'

Sequencing Primer
(F):5'- TGTGTACACCCATGAGCCCAG -3'
(R):5'- CACGAAGGCCACATGCTAGTTTTG -3'
Posted On2019-06-26