Incidental Mutation 'R7271:Impa2'
ID 565327
Institutional Source Beutler Lab
Gene Symbol Impa2
Ensembl Gene ENSMUSG00000024525
Gene Name inositol monophosphatase 2
Synonyms 2210415D20Rik, inositol (myo)-1(or 4)-monophosphatase 2
MMRRC Submission 045356-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R7271 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 67422246-67454375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67439806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 101 (I101N)
Ref Sequence ENSEMBL: ENSMUSP00000025403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025403]
AlphaFold Q91UZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000025403
AA Change: I101N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025403
Gene: ENSMUSG00000024525
AA Change: I101N

DomainStartEndE-ValueType
Pfam:Inositol_P 18 284 7.6e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inositol monophosphatase. The encoded protein catalyzes the dephosphoylration of inositol monophosphate and plays an important role in phosphatidylinositol signaling. This locus may be associated with susceptibility to bipolar disorder. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null gene trap mutation do not exhibit an overt mutant phenotype. Male mice homozygous for a knock-out alle exhibit increased prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l C T 10: 42,291,544 (GRCm39) probably null Het
Ahnak2 A T 12: 112,780,802 (GRCm38) V70E Het
Alpk3 A G 7: 80,728,202 (GRCm39) E444G possibly damaging Het
Amer2 T A 14: 60,617,123 (GRCm39) D439E possibly damaging Het
Ano6 A G 15: 95,811,781 (GRCm39) Y222C probably damaging Het
Atp4a A C 7: 30,421,944 (GRCm39) K827Q probably benign Het
Atp9a G A 2: 168,576,047 (GRCm39) Het
Casp7 T A 19: 56,424,793 (GRCm39) C171S probably damaging Het
Ccdc9b T A 2: 118,591,164 (GRCm39) probably null Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cdkl1 A G 12: 69,795,585 (GRCm39) L315S probably benign Het
Cfap91 A G 16: 38,148,708 (GRCm39) I240T probably damaging Het
Crybg1 G T 10: 43,873,619 (GRCm39) S1163* probably null Het
Csmd1 A T 8: 17,077,295 (GRCm39) W121R probably damaging Het
Cyyr1 A T 16: 85,262,493 (GRCm39) M88K possibly damaging Het
Dlc1 T C 8: 37,049,954 (GRCm39) Q587R probably damaging Het
Dock2 T C 11: 34,223,750 (GRCm39) E1128G possibly damaging Het
Dynap T A 18: 70,374,320 (GRCm39) T69S possibly damaging Het
Esr1 T C 10: 4,733,874 (GRCm39) C225R probably damaging Het
Fbxo31 C T 8: 122,305,503 (GRCm39) probably benign Het
Fndc11 G A 2: 180,863,893 (GRCm39) V233I possibly damaging Het
Fto T C 8: 92,211,818 (GRCm39) F381S probably damaging Het
Gtf2ird1 A G 5: 134,433,758 (GRCm39) L223P probably benign Het
Ifi214 A T 1: 173,357,042 (GRCm39) H20Q probably damaging Het
Kidins220 A T 12: 25,061,570 (GRCm39) T854S probably benign Het
Lamb1 T A 12: 31,337,423 (GRCm39) C385S probably damaging Het
Lrrc8c A G 5: 105,755,853 (GRCm39) S543G probably benign Het
Manba A T 3: 135,248,137 (GRCm39) Y342F probably damaging Het
Map3k1 T C 13: 111,893,231 (GRCm39) D758G probably benign Het
Mtor G T 4: 148,630,942 (GRCm39) A2300S possibly damaging Het
Musk T A 4: 58,373,409 (GRCm39) M793K probably damaging Het
Nup133 A C 8: 124,649,153 (GRCm39) I563S probably benign Het
Or10ab4 G A 7: 107,654,423 (GRCm39) R78Q probably damaging Het
Or10ag55-ps1 T A 2: 87,114,725 (GRCm39) N30K probably benign Het
Or4k77 A G 2: 111,199,693 (GRCm39) T239A probably damaging Het
Or8g21 A T 9: 38,905,953 (GRCm39) Y259* probably null Het
Pcdh12 C A 18: 38,416,100 (GRCm39) V342F probably damaging Het
Pcdhb4 T A 18: 37,441,222 (GRCm39) H177Q possibly damaging Het
Pcnx2 G A 8: 126,613,690 (GRCm39) A587V probably benign Het
Phkb C T 8: 86,770,418 (GRCm39) P896S probably damaging Het
Prss36 A G 7: 127,543,877 (GRCm39) S165P probably benign Het
Prss43 A G 9: 110,657,671 (GRCm39) D190G probably damaging Het
Psmd14 T C 2: 61,591,356 (GRCm39) V53A probably damaging Het
Sel1l3 T G 5: 53,273,704 (GRCm39) H1054P probably damaging Het
Selenoh T C 2: 84,500,631 (GRCm39) R70G probably damaging Het
Serpinb9d A G 13: 33,378,617 (GRCm39) Q21R probably benign Het
Slc29a1 T C 17: 45,899,288 (GRCm39) E262G probably benign Het
Slc7a14 A G 3: 31,278,384 (GRCm39) L407P probably damaging Het
Smyd4 T C 11: 75,281,325 (GRCm39) V266A possibly damaging Het
Spata31d1a T A 13: 59,849,913 (GRCm39) R738S probably benign Het
Speer4a2 G A 5: 26,292,993 (GRCm39) T67I probably benign Het
Srcin1 C T 11: 97,442,715 (GRCm39) G38S probably damaging Het
Stab2 A T 10: 86,838,972 (GRCm39) probably null Het
Syde2 A G 3: 145,726,031 (GRCm39) N1308D possibly damaging Het
Trip11 A T 12: 101,850,611 (GRCm39) M1151K probably damaging Het
Ttll4 A T 1: 74,727,820 (GRCm39) I861F possibly damaging Het
Zfp319 G A 8: 96,058,471 (GRCm39) probably benign Het
Zfp518b T C 5: 38,831,907 (GRCm39) N33D probably benign Het
Zfp874a T A 13: 67,591,415 (GRCm39) I90F probably benign Het
Zmiz2 G T 11: 6,349,593 (GRCm39) V412L probably damaging Het
Other mutations in Impa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1137:Impa2 UTSW 18 67,451,497 (GRCm39) missense probably benign
R5054:Impa2 UTSW 18 67,439,797 (GRCm39) missense probably damaging 1.00
R6030:Impa2 UTSW 18 67,451,498 (GRCm39) missense probably benign 0.36
R6030:Impa2 UTSW 18 67,451,498 (GRCm39) missense probably benign 0.36
R7591:Impa2 UTSW 18 67,451,480 (GRCm39) missense probably damaging 0.97
R8968:Impa2 UTSW 18 67,451,497 (GRCm39) missense probably benign
R9179:Impa2 UTSW 18 67,422,473 (GRCm39) start gained probably benign
Z1177:Impa2 UTSW 18 67,442,122 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTAATCCATCGCTAGCTCCGTG -3'
(R):5'- CTTTAGAGTCACAAGTGGAAAACC -3'

Sequencing Primer
(F):5'- CAACACTGAGAGTCGGTCTG -3'
(R):5'- GAGTCACAAGTGGAAAACCTTTTAAG -3'
Posted On 2019-06-26