Incidental Mutation 'R0583:Ciita'
ID56533
Institutional Source Beutler Lab
Gene Symbol Ciita
Ensembl Gene ENSMUSG00000022504
Gene Nameclass II transactivator
SynonymsC2ta, Gm9475
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0583 (G1)
Quality Score123
Status Not validated
Chromosome16
Chromosomal Location10480059-10528418 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 10523804 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023147] [ENSMUST00000184863] [ENSMUST00000230146] [ENSMUST00000230395] [ENSMUST00000230450]
Predicted Effect probably null
Transcript: ENSMUST00000023147
SMART Domains Protein: ENSMUSP00000023147
Gene: ENSMUSG00000022504

DomainStartEndE-ValueType
low complexity region 216 230 N/A INTRINSIC
Pfam:NACHT 362 533 1.8e-44 PFAM
low complexity region 847 861 N/A INTRINSIC
LRR 931 961 8.53e0 SMART
LRR 962 989 7.37e-4 SMART
LRR 991 1018 1.25e-6 SMART
LRR 1019 1046 2.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184863
SMART Domains Protein: ENSMUSP00000139108
Gene: ENSMUSG00000038055

DomainStartEndE-ValueType
Pfam:Dexa_ind 1 95 4.6e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229906
Predicted Effect probably null
Transcript: ENSMUST00000230146
Predicted Effect probably null
Transcript: ENSMUST00000230395
Predicted Effect probably null
Transcript: ENSMUST00000230450
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NOD-like receptor protein family. This protein acts as a transcriptional coactivator and component of the enhanceosome complex to stimulate transcription of MHC class II genes in the adaptive immune response. This protein may also regulate the transcription of MHC class I genes. Mutations in the human gene have been linked to a rare immunodeficiency, bare lymphocyte syndrome, and homozygous knockout mice exhibit many features of this disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are immunologically abnormal with extremely little MHC class II expression, greatly reduced serum IgG, and impaired T-dependent antigen responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Ciita
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Ciita APN 16 10510727 missense probably damaging 0.99
IGL01830:Ciita APN 16 10521051 missense probably damaging 1.00
IGL02557:Ciita APN 16 10512015 missense probably damaging 1.00
IGL02634:Ciita APN 16 10508713 missense probably damaging 1.00
IGL03057:Ciita APN 16 10520959 splice site probably benign
IGL03403:Ciita APN 16 10503872 missense probably damaging 1.00
deshabille UTSW 16 10509207 intron probably null
sisal UTSW 16 10513288 critical splice donor site probably null
R0001:Ciita UTSW 16 10514433 splice site probably benign
R0138:Ciita UTSW 16 10512270 missense probably damaging 1.00
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1468:Ciita UTSW 16 10513288 critical splice donor site probably null
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1470:Ciita UTSW 16 10514468 missense possibly damaging 0.75
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R1888:Ciita UTSW 16 10511084 missense probably damaging 1.00
R2017:Ciita UTSW 16 10511676 missense probably damaging 1.00
R2072:Ciita UTSW 16 10518353 missense probably benign 0.16
R2410:Ciita UTSW 16 10510704 missense probably damaging 0.99
R4779:Ciita UTSW 16 10511366 missense probably damaging 1.00
R5151:Ciita UTSW 16 10523730 missense probably damaging 1.00
R5233:Ciita UTSW 16 10509401 missense possibly damaging 0.95
R5363:Ciita UTSW 16 10512167 missense probably damaging 1.00
R5431:Ciita UTSW 16 10523792 missense probably damaging 1.00
R5821:Ciita UTSW 16 10511805 missense possibly damaging 0.77
R6085:Ciita UTSW 16 10512165 missense probably benign 0.08
R6088:Ciita UTSW 16 10511931 missense probably damaging 1.00
R6241:Ciita UTSW 16 10511903 missense probably damaging 1.00
R6354:Ciita UTSW 16 10523746 missense probably damaging 1.00
R6502:Ciita UTSW 16 10511910 missense probably damaging 1.00
R6553:Ciita UTSW 16 10511745 missense probably benign 0.00
R6585:Ciita UTSW 16 10511745 missense probably benign 0.00
R6916:Ciita UTSW 16 10509207 intron probably null
R6937:Ciita UTSW 16 10512491 intron probably null
R7007:Ciita UTSW 16 10511307 missense probably damaging 1.00
R7219:Ciita UTSW 16 10512257 missense probably benign 0.00
R7326:Ciita UTSW 16 10512288 missense probably damaging 1.00
RF019:Ciita UTSW 16 10506747 missense probably damaging 0.98
Z1176:Ciita UTSW 16 10508700 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTTACTGCCCATGCTGTTGTATC -3'
(R):5'- TGTTTCCACCTGAGGGCACTTCTG -3'

Sequencing Primer
(F):5'- ttcattccatccccagcac -3'
(R):5'- AGGGCACTTCTGAAGGCTG -3'
Posted On2013-07-11