Incidental Mutation 'R7272:Ice2'
ID565355
Institutional Source Beutler Lab
Gene Symbol Ice2
Ensembl Gene ENSMUSG00000032235
Gene Nameinteractor of little elongation complex ELL subunit 2
SynonymsNarg2, B230343B06Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R7272 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location69397906-69433122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69417083 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 763 (S763T)
Ref Sequence ENSEMBL: ENSMUSP00000034761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034761]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034761
AA Change: S763T

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034761
Gene: ENSMUSG00000032235
AA Change: S763T

DomainStartEndE-ValueType
low complexity region 408 422 N/A INTRINSIC
low complexity region 434 473 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:NARG2_C 726 936 1.7e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Ash1l A G 3: 89,054,634 probably null Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Sorl1 C T 9: 42,063,710 probably null Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Yrdc G A 4: 124,851,027 A85T probably benign Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Ice2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Ice2 APN 9 69416113 missense probably benign 0.04
IGL01626:Ice2 APN 9 69407332 missense probably benign 0.39
IGL03035:Ice2 APN 9 69425688 missense probably benign 0.06
R0227:Ice2 UTSW 9 69412228 missense probably benign 0.08
R1373:Ice2 UTSW 9 69407119 missense probably benign 0.01
R1381:Ice2 UTSW 9 69400527 missense probably damaging 1.00
R1599:Ice2 UTSW 9 69411442 missense probably null 0.01
R1778:Ice2 UTSW 9 69415648 missense probably benign 0.04
R1818:Ice2 UTSW 9 69432101 missense probably benign 0.00
R1829:Ice2 UTSW 9 69407353 missense probably damaging 0.99
R1876:Ice2 UTSW 9 69415575 missense possibly damaging 0.85
R1878:Ice2 UTSW 9 69428576 critical splice donor site probably null
R2026:Ice2 UTSW 9 69416325 missense probably benign 0.00
R2915:Ice2 UTSW 9 69410840 missense probably benign 0.19
R4097:Ice2 UTSW 9 69421671 missense possibly damaging 0.95
R4815:Ice2 UTSW 9 69407118 missense probably damaging 1.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R4861:Ice2 UTSW 9 69415448 missense probably benign 0.00
R5066:Ice2 UTSW 9 69408291 missense probably benign 0.00
R5653:Ice2 UTSW 9 69428380 missense probably benign 0.00
R5898:Ice2 UTSW 9 69408262 missense probably benign 0.08
R5951:Ice2 UTSW 9 69412369 missense possibly damaging 0.67
R6176:Ice2 UTSW 9 69417072 missense probably damaging 1.00
R6566:Ice2 UTSW 9 69416229 missense probably benign
R6632:Ice2 UTSW 9 69428452 missense probably benign 0.07
R7195:Ice2 UTSW 9 69428500 missense possibly damaging 0.91
R7365:Ice2 UTSW 9 69400512 missense probably damaging 1.00
R7495:Ice2 UTSW 9 69416229 missense probably benign 0.01
R7535:Ice2 UTSW 9 69432078 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACAATGCATAAAGGGGTTGC -3'
(R):5'- CAGCATTTACGATGATGGAGTG -3'

Sequencing Primer
(F):5'- AAGGGGTTGCATACTTTTAAATGG -3'
(R):5'- CATTTACGATGATGGAGTGTGTATC -3'
Posted On2019-06-26