Mutagenetix > Incidental Mutations

Incidental Mutation 'R7272:Vgll2'

565357

Institutional Source

Beutler Lab

Gene Symbol

Vgll2

Ensembl Gene

ENSMUSG00000049641

Gene Name

vestigial like family member 2

Synonyms

C130057C21Rik, Vito1, VITO-1, Vgl-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.843) question?

Stock #

R7272 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52022502-52028471 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 52027662 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 207 (A207E)

Ref Sequence

ENSEMBL: ENSMUSP00000124091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058347
AA Change: A206E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: A206E

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
Pfam:Vg_Tdu	78	110	7.6e-27	PFAM
low complexity region	192	204	N/A	INTRINSIC
low complexity region	206	213	N/A	INTRINSIC
low complexity region	245	262	N/A	INTRINSIC
low complexity region	269	282	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163017
AA Change: A207E

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: A207E

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
Pfam:Vg_Tdu	78	108	1.1e-23	PFAM
low complexity region	193	205	N/A	INTRINSIC
low complexity region	207	214	N/A	INTRINSIC
low complexity region	246	263	N/A	INTRINSIC
low complexity region	270	283	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,323,536	I1020T	probably benign	Het
2310057N15Rik	A	T	16: 88,773,635	Y172*	probably null	Het
4930558K02Rik	T	A	1: 161,942,523	Y139F	possibly damaging	Het
A830018L16Rik	T	G	1: 11,588,471	M202R	probably damaging	Het
Abca12	T	C	1: 71,248,432	E2450G	probably damaging	Het
Ank2	C	T	3: 126,943,133	R3034H	unknown	Het
Anxa9	A	G	3: 95,305,873	I54T	probably damaging	Het
Ash1l	A	G	3: 89,054,634		probably null	Het
Aspm	T	C	1: 139,458,328	I570T	probably benign	Het
Bcar3	A	T	3: 122,508,396	I247F	possibly damaging	Het
Cep350	A	G	1: 155,953,588	V130A	probably damaging	Het
Cep89	A	T	7: 35,438,463	R757S	probably benign	Het
Cryga	A	T	1: 65,103,222	I4N	probably damaging	Het
Cyp2d26	T	A	15: 82,792,563	Y194F	probably benign	Het
Edn2	G	A	4: 120,161,946	R44H	probably damaging	Het
Ep400	G	A	5: 110,755,645	Q363*	probably null	Het
Gpr33	T	C	12: 52,024,065	T64A	probably damaging	Het
Ice2	T	A	9: 69,417,083	S763T	possibly damaging	Het
Itgad	C	A	7: 128,205,073	F1169L	probably damaging	Het
Kcnv1	A	G	15: 45,113,180	L237P	probably benign	Het
Kctd18	T	C	1: 57,956,551	E356G	probably damaging	Het
Krt33a	C	T	11: 100,012,011	R329Q	probably damaging	Het
Lama2	C	A	10: 27,124,556	G1657C	probably damaging	Het
March3	T	G	18: 56,762,521	R217S	probably benign	Het
Mmel1	A	T	4: 154,894,090	T660S	probably damaging	Het
Ms4a7	T	A	19: 11,333,278	K59*	probably null	Het
Mss51	G	A	14: 20,484,913	T263I	probably damaging	Het
Ncaph2	A	G	15: 89,364,182	M199V	probably benign	Het
Ndufa4	G	A	6: 11,905,210	Q62*	probably null	Het
Nectin4	A	G	1: 171,386,644	T456A	probably damaging	Het
Nek1	T	C	8: 61,125,086	M1214T	probably benign	Het
Nsf	T	A	11: 103,827,238	L710F	probably damaging	Het
Nynrin	G	T	14: 55,870,415	G993V	probably damaging	Het
Olfr391-ps	T	A	11: 73,798,869	D296V	probably damaging	Het
Pbk	T	A	14: 65,815,172	Y155N	probably damaging	Het
Plec	T	C	15: 76,174,953	I3595V	possibly damaging	Het
Pom121	G	A	5: 135,381,087	T1072I	unknown	Het
Sdc1	T	A	12: 8,790,554	H106Q	probably benign	Het
Slc44a3	T	C	3: 121,461,115	D618G	probably damaging	Het
Slc9c1	A	G	16: 45,581,515	D755G	possibly damaging	Het
Slfn9	T	C	11: 82,981,561	Y783C	probably benign	Het
Sorl1	C	T	9: 42,063,710		probably null	Het
Spindoc	C	T	19: 7,382,720	E28K	possibly damaging	Het
Sptbn1	T	C	11: 30,114,859	D1880G	possibly damaging	Het
Sspn	T	A	6: 145,961,474	D210E	probably benign	Het
Stx12	A	T	4: 132,857,376	I219K	possibly damaging	Het
Syne2	T	C	12: 76,048,643	V508A	probably benign	Het
Tkt	G	T	14: 30,565,607	R186L	probably damaging	Het
Trmt10a	T	A	3: 138,154,766	M241K	probably damaging	Het
Vmn1r114	A	G	7: 20,811,618	F190S	probably damaging	Het
Xpot	C	T	10: 121,617,189		probably null	Het
Yrdc	G	A	4: 124,851,027	A85T	probably benign	Het
Zfp385c	C	T	11: 100,630,039	R265K	possibly damaging	Het
Zgrf1	A	T	3: 127,598,760	I1310F	probably damaging	Het

Other mutations in Vgll2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02436:Vgll2	APN	10	52025222	nonsense	probably null
R1796:Vgll2	UTSW	10	52025228	missense	probably damaging	1.00
R5193:Vgll2	UTSW	10	52027992	missense	possibly damaging	0.96
R5397:Vgll2	UTSW	10	52025166	missense	probably damaging	1.00
R5614:Vgll2	UTSW	10	52025222	nonsense	probably null
R5766:Vgll2	UTSW	10	52027563	missense	probably damaging	1.00
R5842:Vgll2	UTSW	10	52025292	missense	probably damaging	1.00
R7063:Vgll2	UTSW	10	52027976	missense	probably benign	0.00
Z1176:Vgll2	UTSW	10	52027602	missense	possibly damaging	0.94
Z1177:Vgll2	UTSW	10	52027808	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- TCCTTAGAAGAGCACCCAGAG -3'
(R):5'- TTACCTGAGTCCACGCTGAGAC -3'

Sequencing Primer
(F):5'- ACTGACTGCCGTGACACTC -3'
(R):5'- GCTGAGACCCAGGCTCTG -3'

Posted On

2019-06-26