Mutagenetix > Incidental Mutation

Incidental Mutation 'R7272:Sptbn1'

565359

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic

MMRRC Submission

045391-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7272 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30049395-30218175 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30064859 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1880 (D1880G)

Ref Sequence

ENSEMBL: ENSMUSP00000011877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006629
AA Change: D1880G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: D1880G

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011877
AA Change: D1880G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: D1880G

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102838
AA Change: D1867G

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: D1867G

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124231
AA Change: D1880G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: D1880G

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,471,655 (GRCm39)	I1020T	probably benign	Het
2310057N15Rik	A	T	16: 88,570,523 (GRCm39)	Y172*	probably null	Het
4930558K02Rik	T	A	1: 161,770,092 (GRCm39)	Y139F	possibly damaging	Het
A830018L16Rik	T	G	1: 11,658,695 (GRCm39)	M202R	probably damaging	Het
Abca12	T	C	1: 71,287,591 (GRCm39)	E2450G	probably damaging	Het
Ank2	C	T	3: 126,736,782 (GRCm39)	R3034H	unknown	Het
Anxa9	A	G	3: 95,213,184 (GRCm39)	I54T	probably damaging	Het
Ash1l	A	G	3: 88,961,941 (GRCm39)		probably null	Het
Aspm	T	C	1: 139,386,066 (GRCm39)	I570T	probably benign	Het
Bcar3	A	T	3: 122,302,045 (GRCm39)	I247F	possibly damaging	Het
Cep350	A	G	1: 155,829,334 (GRCm39)	V130A	probably damaging	Het
Cep89	A	T	7: 35,137,888 (GRCm39)	R757S	probably benign	Het
Cryga	A	T	1: 65,142,381 (GRCm39)	I4N	probably damaging	Het
Cyp2d26	T	A	15: 82,676,764 (GRCm39)	Y194F	probably benign	Het
Edn2	G	A	4: 120,019,143 (GRCm39)	R44H	probably damaging	Het
Ep400	G	A	5: 110,903,511 (GRCm39)	Q363*	probably null	Het
Gpr33	T	C	12: 52,070,848 (GRCm39)	T64A	probably damaging	Het
Ice2	T	A	9: 69,324,365 (GRCm39)	S763T	possibly damaging	Het
Itgad	C	A	7: 127,804,245 (GRCm39)	F1169L	probably damaging	Het
Kcnv1	A	G	15: 44,976,576 (GRCm39)	L237P	probably benign	Het
Kctd18	T	C	1: 57,995,710 (GRCm39)	E356G	probably damaging	Het
Krt33a	C	T	11: 99,902,837 (GRCm39)	R329Q	probably damaging	Het
Lama2	C	A	10: 27,000,552 (GRCm39)	G1657C	probably damaging	Het
Marchf3	T	G	18: 56,895,593 (GRCm39)	R217S	probably benign	Het
Mmel1	A	T	4: 154,978,547 (GRCm39)	T660S	probably damaging	Het
Ms4a7	T	A	19: 11,310,642 (GRCm39)	K59*	probably null	Het
Mss51	G	A	14: 20,534,981 (GRCm39)	T263I	probably damaging	Het
Ncaph2	A	G	15: 89,248,385 (GRCm39)	M199V	probably benign	Het
Ndufa4	G	A	6: 11,905,209 (GRCm39)	Q62*	probably null	Het
Nectin4	A	G	1: 171,214,212 (GRCm39)	T456A	probably damaging	Het
Nek1	T	C	8: 61,578,120 (GRCm39)	M1214T	probably benign	Het
Nsf	T	A	11: 103,718,064 (GRCm39)	L710F	probably damaging	Het
Nynrin	G	T	14: 56,107,872 (GRCm39)	G993V	probably damaging	Het
Or1e31	T	A	11: 73,689,695 (GRCm39)	D296V	probably damaging	Het
Pbk	T	A	14: 66,052,621 (GRCm39)	Y155N	probably damaging	Het
Plec	T	C	15: 76,059,153 (GRCm39)	I3595V	possibly damaging	Het
Pom121	G	A	5: 135,409,941 (GRCm39)	T1072I	unknown	Het
Sdc1	T	A	12: 8,840,554 (GRCm39)	H106Q	probably benign	Het
Slc44a3	T	C	3: 121,254,764 (GRCm39)	D618G	probably damaging	Het
Slc9c1	A	G	16: 45,401,878 (GRCm39)	D755G	possibly damaging	Het
Slfn9	T	C	11: 82,872,387 (GRCm39)	Y783C	probably benign	Het
Sorl1	C	T	9: 41,975,006 (GRCm39)		probably null	Het
Spindoc	C	T	19: 7,360,085 (GRCm39)	E28K	possibly damaging	Het
Sspn	T	A	6: 145,907,200 (GRCm39)	D210E	probably benign	Het
Stx12	A	T	4: 132,584,687 (GRCm39)	I219K	possibly damaging	Het
Syne2	T	C	12: 76,095,417 (GRCm39)	V508A	probably benign	Het
Tkt	G	T	14: 30,287,564 (GRCm39)	R186L	probably damaging	Het
Trmt10a	T	A	3: 137,860,527 (GRCm39)	M241K	probably damaging	Het
Vgll2	C	A	10: 51,903,758 (GRCm39)	A207E	possibly damaging	Het
Vmn1r114	A	G	7: 20,545,543 (GRCm39)	F190S	probably damaging	Het
Xpot	C	T	10: 121,453,094 (GRCm39)		probably null	Het
Yrdc	G	A	4: 124,744,820 (GRCm39)	A85T	probably benign	Het
Zfp385c	C	T	11: 100,520,865 (GRCm39)	R265K	possibly damaging	Het
Zgrf1	A	T	3: 127,392,409 (GRCm39)	I1310F	probably damaging	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30,060,818 (GRCm39)	nonsense	probably null
IGL01098:Sptbn1	APN	11	30,109,385 (GRCm39)	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30,054,623 (GRCm39)	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30,095,979 (GRCm39)	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30,088,496 (GRCm39)	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30,050,659 (GRCm39)	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30,087,427 (GRCm39)	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30,067,871 (GRCm39)	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30,070,990 (GRCm39)	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30,092,129 (GRCm39)	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30,069,491 (GRCm39)	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30,092,293 (GRCm39)	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30,087,239 (GRCm39)	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30,147,747 (GRCm39)	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30,092,247 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30,092,289 (GRCm39)	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30,071,545 (GRCm39)	missense	probably benign
R0389:Sptbn1	UTSW	11	30,089,250 (GRCm39)	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30,099,576 (GRCm39)	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30,095,985 (GRCm39)	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30,100,008 (GRCm39)	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30,088,979 (GRCm39)	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30,067,903 (GRCm39)	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30,060,902 (GRCm39)	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30,089,016 (GRCm39)	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30,092,201 (GRCm39)	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30,071,591 (GRCm39)	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30,070,785 (GRCm39)	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30,088,637 (GRCm39)	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30,063,909 (GRCm39)	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30,071,498 (GRCm39)	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30,087,301 (GRCm39)	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30,070,783 (GRCm39)	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30,092,245 (GRCm39)	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30,109,371 (GRCm39)	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30,086,124 (GRCm39)	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30,064,781 (GRCm39)	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30,092,414 (GRCm39)	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30,054,469 (GRCm39)	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30,054,559 (GRCm39)	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30,109,293 (GRCm39)	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30,088,360 (GRCm39)	splice site	probably benign
R2312:Sptbn1	UTSW	11	30,104,249 (GRCm39)	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30,169,686 (GRCm39)	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30,090,593 (GRCm39)	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30,087,335 (GRCm39)	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30,092,329 (GRCm39)	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30,089,114 (GRCm39)	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30,169,597 (GRCm39)	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign
R4707:Sptbn1	UTSW	11	30,087,197 (GRCm39)	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30,104,297 (GRCm39)	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30,067,759 (GRCm39)	missense	probably benign
R4824:Sptbn1	UTSW	11	30,068,295 (GRCm39)	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30,092,353 (GRCm39)	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30,074,016 (GRCm39)	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30,063,854 (GRCm39)	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30,071,510 (GRCm39)	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30,087,364 (GRCm39)	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30,050,520 (GRCm39)	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30,087,560 (GRCm39)	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30,093,174 (GRCm39)	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30,094,113 (GRCm39)	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30,095,941 (GRCm39)	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30,095,925 (GRCm39)	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30,073,978 (GRCm39)	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30,086,136 (GRCm39)	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30,074,873 (GRCm39)	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30,068,464 (GRCm39)	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30,087,403 (GRCm39)	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30,109,443 (GRCm39)	nonsense	probably null
R6226:Sptbn1	UTSW	11	30,086,054 (GRCm39)	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30,089,429 (GRCm39)	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30,074,030 (GRCm39)	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30,067,859 (GRCm39)	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30,064,787 (GRCm39)	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30,096,777 (GRCm39)	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30,088,634 (GRCm39)	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30,092,187 (GRCm39)	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30,050,633 (GRCm39)	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30,053,323 (GRCm39)	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30,087,119 (GRCm39)	missense	possibly damaging	0.75
R7301:Sptbn1	UTSW	11	30,067,798 (GRCm39)	nonsense	probably null
R7379:Sptbn1	UTSW	11	30,089,292 (GRCm39)	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30,092,142 (GRCm39)	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30,088,455 (GRCm39)	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30,088,832 (GRCm39)	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30,104,320 (GRCm39)	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30,092,153 (GRCm39)	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30,079,601 (GRCm39)	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30,086,048 (GRCm39)	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30,051,616 (GRCm39)	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30,089,117 (GRCm39)	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30,147,783 (GRCm39)	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30,074,972 (GRCm39)	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30,063,906 (GRCm39)	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30,088,457 (GRCm39)	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30,070,758 (GRCm39)	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30,169,750 (GRCm39)	start gained	probably benign
R8674:Sptbn1	UTSW	11	30,089,352 (GRCm39)	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30,075,009 (GRCm39)	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30,073,869 (GRCm39)	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30,087,526 (GRCm39)	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30,104,356 (GRCm39)	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30,087,551 (GRCm39)	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30,096,803 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30,147,787 (GRCm39)	missense	probably benign	0.13
Z1176:Sptbn1	UTSW	11	30,087,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30,070,659 (GRCm39)	missense	probably benign	0.27
Z1177:Sptbn1	UTSW	11	30,064,734 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCTCTTCCCTGAACACC -3'
(R):5'- GTATTAAGAGGCACAGACCCG -3'

Sequencing Primer
(F):5'- GGAGCCTTACCGTGGTTTCTC -3'
(R):5'- GGCACAGACCCGGCAAC -3'

Posted On

2019-06-26