Incidental Mutation 'R0583:Vmn2r102'
ID56536
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Namevomeronasal 2, receptor 102
SynonymsEG224572
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0583 (G1)
Quality Score169
Status Not validated
Chromosome17
Chromosomal Location19660399-19694748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19676781 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 130 (V130E)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
Predicted Effect probably benign
Transcript: ENSMUST00000171741
AA Change: V130E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: V130E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19694368 missense probably damaging 1.00
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R0879:Vmn2r102 UTSW 17 19694192 missense probably damaging 1.00
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19678831 missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19694131 missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7009:Vmn2r102 UTSW 17 19694194 missense probably damaging 0.99
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
R8126:Vmn2r102 UTSW 17 19660450 missense probably benign 0.02
Z1176:Vmn2r102 UTSW 17 19694043 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTGAAAACAACAGATGTGCTCTTTGG -3'
(R):5'- ACTGACTCTCAGTTCCCACAATCCA -3'

Sequencing Primer
(F):5'- AGGAGCTTACCTAAACCTATTTACC -3'
(R):5'- ACAATCCAAATTTTCTCACCTGTG -3'
Posted On2013-07-11