Incidental Mutation 'R7272:Olfr391-ps'
ID565360
Institutional Source Beutler Lab
Gene Symbol Olfr391-ps
Ensembl Gene ENSMUSG00000070382
Gene Nameolfactory receptor 391, pseudogene
SynonymsMOR135-24, GA_x6K02T2P1NL-3951666-3950698, MOR135-30_i, Olfr391-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7272 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73797861-73803052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73798869 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 296 (D296V)
Ref Sequence ENSEMBL: ENSMUSP00000151029 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000214485
AA Change: D296V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Ash1l A G 3: 89,054,634 probably null Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Sorl1 C T 9: 42,063,710 probably null Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Yrdc G A 4: 124,851,027 A85T probably benign Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Olfr391-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2967:Olfr391-ps UTSW 11 73799107 missense possibly damaging 0.95
R4782:Olfr391-ps UTSW 11 73798839 missense probably benign 0.00
R5011:Olfr391-ps UTSW 11 73799647 missense possibly damaging 0.56
R5984:Olfr391-ps UTSW 11 73799581 missense possibly damaging 0.95
R6276:Olfr391-ps UTSW 11 73799403 missense probably damaging 1.00
R6338:Olfr391-ps UTSW 11 73799319 missense possibly damaging 0.93
R6835:Olfr391-ps UTSW 11 73799235 missense possibly damaging 0.95
R6968:Olfr391-ps UTSW 11 73799379 missense possibly damaging 0.86
R7125:Olfr391-ps UTSW 11 73799164 missense probably benign 0.00
R7258:Olfr391-ps UTSW 11 73799380 missense probably damaging 0.98
R7665:Olfr391-ps UTSW 11 73798961 missense probably benign 0.03
R8053:Olfr391-ps UTSW 11 73798996 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAAAGACCACCTTTCTTACTTTGAC -3'
(R):5'- GGATCTACAAGGTCTTCTCCACC -3'

Sequencing Primer
(F):5'- TTTGACTACTCCACAAAAACTCTTC -3'
(R):5'- CTGTGGTTCCCATCTGTCTGTG -3'
Posted On2019-06-26