Incidental Mutation 'R7272:Nynrin'
ID565371
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7272 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55870415 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 993 (G993V)
Ref Sequence ENSEMBL: ENSMUSP00000098098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479]
Predicted Effect probably damaging
Transcript: ENSMUST00000100529
AA Change: G993V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: G993V

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168479
AA Change: G993V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: G993V

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Ash1l A G 3: 89,054,634 probably null Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Sorl1 C T 9: 42,063,710 probably null Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Yrdc G A 4: 124,851,027 A85T probably benign Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
R7584:Nynrin UTSW 14 55871584 missense probably damaging 1.00
R7677:Nynrin UTSW 14 55870236 missense probably benign
R7723:Nynrin UTSW 14 55872045 missense possibly damaging 0.87
R7776:Nynrin UTSW 14 55865963 missense probably damaging 1.00
R7787:Nynrin UTSW 14 55870523 missense probably benign
R7842:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7852:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R7925:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7935:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R8040:Nynrin UTSW 14 55871525 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAACTGAGTGATGACGCTGAC -3'
(R):5'- TCAGAGATAACATCCCGGTGG -3'

Sequencing Primer
(F):5'- ACGCCGAACCTTTGGAGGATC -3'
(R):5'- GTGGGAATCCATGAAGCCC -3'
Posted On2019-06-26