Incidental Mutation 'R7272:Cyp2d26'
ID565375
Institutional Source Beutler Lab
Gene Symbol Cyp2d26
Ensembl Gene ENSMUSG00000022445
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms1300006E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7272 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82790101-82794294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82792563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 194 (Y194F)
Ref Sequence ENSEMBL: ENSMUSP00000006094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006094] [ENSMUST00000229387] [ENSMUST00000229512]
Predicted Effect probably benign
Transcript: ENSMUST00000006094
AA Change: Y194F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006094
Gene: ENSMUSG00000022445
AA Change: Y194F

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:p450 37 497 3.5e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229387
Predicted Effect probably benign
Transcript: ENSMUST00000229512
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Ash1l A G 3: 89,054,634 probably null Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slc9c1 A G 16: 45,581,515 D755G possibly damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Sorl1 C T 9: 42,063,710 probably null Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Yrdc G A 4: 124,851,027 A85T probably benign Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Cyp2d26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cyp2d26 APN 15 82791043 missense probably benign 0.31
IGL00670:Cyp2d26 APN 15 82791741 missense probably benign
IGL01646:Cyp2d26 APN 15 82791418 missense probably benign 0.00
IGL01915:Cyp2d26 APN 15 82790249 missense probably benign 0.06
IGL01940:Cyp2d26 APN 15 82792557 missense probably benign 0.00
IGL02127:Cyp2d26 APN 15 82791106 missense probably benign 0.09
IGL02452:Cyp2d26 APN 15 82792626 missense probably benign 0.00
IGL03216:Cyp2d26 APN 15 82793261 missense probably benign
IGL03377:Cyp2d26 APN 15 82790554 missense possibly damaging 0.47
R0149:Cyp2d26 UTSW 15 82792767 missense probably damaging 1.00
R0848:Cyp2d26 UTSW 15 82790233 missense probably benign 0.00
R1165:Cyp2d26 UTSW 15 82794041 missense probably damaging 1.00
R1217:Cyp2d26 UTSW 15 82792867 splice site probably benign
R1780:Cyp2d26 UTSW 15 82794007 missense probably damaging 1.00
R2048:Cyp2d26 UTSW 15 82792727 utr 3 prime probably benign
R2152:Cyp2d26 UTSW 15 82792706 critical splice donor site probably null
R2397:Cyp2d26 UTSW 15 82794035 missense probably damaging 1.00
R4702:Cyp2d26 UTSW 15 82792447 intron probably benign
R5157:Cyp2d26 UTSW 15 82790989 missense probably benign 0.01
R5444:Cyp2d26 UTSW 15 82792538 missense probably benign 0.18
R6017:Cyp2d26 UTSW 15 82790573 missense possibly damaging 0.68
R6223:Cyp2d26 UTSW 15 82791717 missense probably benign 0.04
R6390:Cyp2d26 UTSW 15 82792624 missense possibly damaging 0.68
R6473:Cyp2d26 UTSW 15 82791767 missense probably benign 0.02
R6858:Cyp2d26 UTSW 15 82794083 missense probably damaging 1.00
R6912:Cyp2d26 UTSW 15 82791119 missense probably benign 0.16
R6936:Cyp2d26 UTSW 15 82792540 missense probably benign 0.14
R6960:Cyp2d26 UTSW 15 82790245 missense probably damaging 0.98
R7053:Cyp2d26 UTSW 15 82792600 missense probably benign 0.00
R7113:Cyp2d26 UTSW 15 82790202 missense probably benign 0.02
R7126:Cyp2d26 UTSW 15 82794008 missense probably benign 0.00
R7771:Cyp2d26 UTSW 15 82791746 missense probably benign
X0021:Cyp2d26 UTSW 15 82790517 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGGTTTGTCAACACCCAAGC -3'
(R):5'- TCTGCGATGCTTTCACCAAG -3'

Sequencing Primer
(F):5'- TTGGCCATCACACCAGGC -3'
(R):5'- ATGCTTTCACCAAGGAGGC -3'
Posted On2019-06-26