Incidental Mutation 'R7272:Slc9c1'
ID 565377
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 045391-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R7272 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45401878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 755 (D755G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: D755G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: D755G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,471,655 (GRCm39) I1020T probably benign Het
2310057N15Rik A T 16: 88,570,523 (GRCm39) Y172* probably null Het
4930558K02Rik T A 1: 161,770,092 (GRCm39) Y139F possibly damaging Het
A830018L16Rik T G 1: 11,658,695 (GRCm39) M202R probably damaging Het
Abca12 T C 1: 71,287,591 (GRCm39) E2450G probably damaging Het
Ank2 C T 3: 126,736,782 (GRCm39) R3034H unknown Het
Anxa9 A G 3: 95,213,184 (GRCm39) I54T probably damaging Het
Ash1l A G 3: 88,961,941 (GRCm39) probably null Het
Aspm T C 1: 139,386,066 (GRCm39) I570T probably benign Het
Bcar3 A T 3: 122,302,045 (GRCm39) I247F possibly damaging Het
Cep350 A G 1: 155,829,334 (GRCm39) V130A probably damaging Het
Cep89 A T 7: 35,137,888 (GRCm39) R757S probably benign Het
Cryga A T 1: 65,142,381 (GRCm39) I4N probably damaging Het
Cyp2d26 T A 15: 82,676,764 (GRCm39) Y194F probably benign Het
Edn2 G A 4: 120,019,143 (GRCm39) R44H probably damaging Het
Ep400 G A 5: 110,903,511 (GRCm39) Q363* probably null Het
Gpr33 T C 12: 52,070,848 (GRCm39) T64A probably damaging Het
Ice2 T A 9: 69,324,365 (GRCm39) S763T possibly damaging Het
Itgad C A 7: 127,804,245 (GRCm39) F1169L probably damaging Het
Kcnv1 A G 15: 44,976,576 (GRCm39) L237P probably benign Het
Kctd18 T C 1: 57,995,710 (GRCm39) E356G probably damaging Het
Krt33a C T 11: 99,902,837 (GRCm39) R329Q probably damaging Het
Lama2 C A 10: 27,000,552 (GRCm39) G1657C probably damaging Het
Marchf3 T G 18: 56,895,593 (GRCm39) R217S probably benign Het
Mmel1 A T 4: 154,978,547 (GRCm39) T660S probably damaging Het
Ms4a7 T A 19: 11,310,642 (GRCm39) K59* probably null Het
Mss51 G A 14: 20,534,981 (GRCm39) T263I probably damaging Het
Ncaph2 A G 15: 89,248,385 (GRCm39) M199V probably benign Het
Ndufa4 G A 6: 11,905,209 (GRCm39) Q62* probably null Het
Nectin4 A G 1: 171,214,212 (GRCm39) T456A probably damaging Het
Nek1 T C 8: 61,578,120 (GRCm39) M1214T probably benign Het
Nsf T A 11: 103,718,064 (GRCm39) L710F probably damaging Het
Nynrin G T 14: 56,107,872 (GRCm39) G993V probably damaging Het
Or1e31 T A 11: 73,689,695 (GRCm39) D296V probably damaging Het
Pbk T A 14: 66,052,621 (GRCm39) Y155N probably damaging Het
Plec T C 15: 76,059,153 (GRCm39) I3595V possibly damaging Het
Pom121 G A 5: 135,409,941 (GRCm39) T1072I unknown Het
Sdc1 T A 12: 8,840,554 (GRCm39) H106Q probably benign Het
Slc44a3 T C 3: 121,254,764 (GRCm39) D618G probably damaging Het
Slfn9 T C 11: 82,872,387 (GRCm39) Y783C probably benign Het
Sorl1 C T 9: 41,975,006 (GRCm39) probably null Het
Spindoc C T 19: 7,360,085 (GRCm39) E28K possibly damaging Het
Sptbn1 T C 11: 30,064,859 (GRCm39) D1880G possibly damaging Het
Sspn T A 6: 145,907,200 (GRCm39) D210E probably benign Het
Stx12 A T 4: 132,584,687 (GRCm39) I219K possibly damaging Het
Syne2 T C 12: 76,095,417 (GRCm39) V508A probably benign Het
Tkt G T 14: 30,287,564 (GRCm39) R186L probably damaging Het
Trmt10a T A 3: 137,860,527 (GRCm39) M241K probably damaging Het
Vgll2 C A 10: 51,903,758 (GRCm39) A207E possibly damaging Het
Vmn1r114 A G 7: 20,545,543 (GRCm39) F190S probably damaging Het
Xpot C T 10: 121,453,094 (GRCm39) probably null Het
Yrdc G A 4: 124,744,820 (GRCm39) A85T probably benign Het
Zfp385c C T 11: 100,520,865 (GRCm39) R265K possibly damaging Het
Zgrf1 A T 3: 127,392,409 (GRCm39) I1310F probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACGAGTCTGTTGAAGGAGGC -3'
(R):5'- GTGATGTAGCAAGCCAGGAATC -3'

Sequencing Primer
(F):5'- CTGTTGAAGGAGGCAGCTGC -3'
(R):5'- ACTCGGGACATGTGCATG -3'
Posted On 2019-06-26