Incidental Mutation 'R7272:Slc9c1'
ID565377
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R7272 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45581515 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 755 (D755G)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: D755G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: D755G

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,536 I1020T probably benign Het
2310057N15Rik A T 16: 88,773,635 Y172* probably null Het
4930558K02Rik T A 1: 161,942,523 Y139F possibly damaging Het
A830018L16Rik T G 1: 11,588,471 M202R probably damaging Het
Abca12 T C 1: 71,248,432 E2450G probably damaging Het
Ank2 C T 3: 126,943,133 R3034H unknown Het
Anxa9 A G 3: 95,305,873 I54T probably damaging Het
Ash1l A G 3: 89,054,634 probably null Het
Aspm T C 1: 139,458,328 I570T probably benign Het
Bcar3 A T 3: 122,508,396 I247F possibly damaging Het
Cep350 A G 1: 155,953,588 V130A probably damaging Het
Cep89 A T 7: 35,438,463 R757S probably benign Het
Cryga A T 1: 65,103,222 I4N probably damaging Het
Cyp2d26 T A 15: 82,792,563 Y194F probably benign Het
Edn2 G A 4: 120,161,946 R44H probably damaging Het
Ep400 G A 5: 110,755,645 Q363* probably null Het
Gpr33 T C 12: 52,024,065 T64A probably damaging Het
Ice2 T A 9: 69,417,083 S763T possibly damaging Het
Itgad C A 7: 128,205,073 F1169L probably damaging Het
Kcnv1 A G 15: 45,113,180 L237P probably benign Het
Kctd18 T C 1: 57,956,551 E356G probably damaging Het
Krt33a C T 11: 100,012,011 R329Q probably damaging Het
Lama2 C A 10: 27,124,556 G1657C probably damaging Het
March3 T G 18: 56,762,521 R217S probably benign Het
Mmel1 A T 4: 154,894,090 T660S probably damaging Het
Ms4a7 T A 19: 11,333,278 K59* probably null Het
Mss51 G A 14: 20,484,913 T263I probably damaging Het
Ncaph2 A G 15: 89,364,182 M199V probably benign Het
Ndufa4 G A 6: 11,905,210 Q62* probably null Het
Nectin4 A G 1: 171,386,644 T456A probably damaging Het
Nek1 T C 8: 61,125,086 M1214T probably benign Het
Nsf T A 11: 103,827,238 L710F probably damaging Het
Nynrin G T 14: 55,870,415 G993V probably damaging Het
Olfr391-ps T A 11: 73,798,869 D296V probably damaging Het
Pbk T A 14: 65,815,172 Y155N probably damaging Het
Plec T C 15: 76,174,953 I3595V possibly damaging Het
Pom121 G A 5: 135,381,087 T1072I unknown Het
Sdc1 T A 12: 8,790,554 H106Q probably benign Het
Slc44a3 T C 3: 121,461,115 D618G probably damaging Het
Slfn9 T C 11: 82,981,561 Y783C probably benign Het
Sorl1 C T 9: 42,063,710 probably null Het
Spindoc C T 19: 7,382,720 E28K possibly damaging Het
Sptbn1 T C 11: 30,114,859 D1880G possibly damaging Het
Sspn T A 6: 145,961,474 D210E probably benign Het
Stx12 A T 4: 132,857,376 I219K possibly damaging Het
Syne2 T C 12: 76,048,643 V508A probably benign Het
Tkt G T 14: 30,565,607 R186L probably damaging Het
Trmt10a T A 3: 138,154,766 M241K probably damaging Het
Vgll2 C A 10: 52,027,662 A207E possibly damaging Het
Vmn1r114 A G 7: 20,811,618 F190S probably damaging Het
Xpot C T 10: 121,617,189 probably null Het
Yrdc G A 4: 124,851,027 A85T probably benign Het
Zfp385c C T 11: 100,630,039 R265K possibly damaging Het
Zgrf1 A T 3: 127,598,760 I1310F probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R7964:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACGAGTCTGTTGAAGGAGGC -3'
(R):5'- GTGATGTAGCAAGCCAGGAATC -3'

Sequencing Primer
(F):5'- CTGTTGAAGGAGGCAGCTGC -3'
(R):5'- ACTCGGGACATGTGCATG -3'
Posted On2019-06-26