Incidental Mutation 'R0583:Ccdc154'
ID56538
Institutional Source Beutler Lab
Gene Symbol Ccdc154
Ensembl Gene ENSMUSG00000059562
Gene Namecoiled-coil domain containing 154
SynonymsLOC207209
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R0583 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25162461-25171913 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25168424 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 375 (D375E)
Ref Sequence ENSEMBL: ENSMUSP00000138191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073277] [ENSMUST00000182292] [ENSMUST00000182621] [ENSMUST00000183178] [ENSMUST00000224277]
Predicted Effect probably benign
Transcript: ENSMUST00000073277
AA Change: D384E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000073002
Gene: ENSMUSG00000059562
AA Change: D384E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 48 578 1.4e-263 PFAM
low complexity region 631 642 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182292
AA Change: D375E

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138191
Gene: ENSMUSG00000059562
AA Change: D375E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 571 1.3e-250 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182621
AA Change: D377E

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138090
Gene: ENSMUSG00000059562
AA Change: D377E

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:DUF4631 47 573 2.9e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183178
SMART Domains Protein: ENSMUSP00000138659
Gene: ENSMUSG00000059562

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224277
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Ccdc154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Ccdc154 APN 17 25167818 critical splice donor site probably null
IGL02427:Ccdc154 APN 17 25171757 critical splice acceptor site probably null
IGL03188:Ccdc154 APN 17 25164093 critical splice acceptor site probably null
R0256:Ccdc154 UTSW 17 25170632 missense probably benign 0.19
R0328:Ccdc154 UTSW 17 25171805 missense probably benign 0.25
R0671:Ccdc154 UTSW 17 25167285 splice site probably benign
R0898:Ccdc154 UTSW 17 25164081 splice site probably benign
R1758:Ccdc154 UTSW 17 25163182 missense probably damaging 0.99
R2165:Ccdc154 UTSW 17 25170890 missense probably damaging 1.00
R2169:Ccdc154 UTSW 17 25170923 missense probably damaging 1.00
R4810:Ccdc154 UTSW 17 25163498 missense probably damaging 1.00
R4853:Ccdc154 UTSW 17 25170967 missense probably damaging 1.00
R4959:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R4973:Ccdc154 UTSW 17 25170914 missense probably damaging 1.00
R5040:Ccdc154 UTSW 17 25164592 missense probably benign 0.04
R5153:Ccdc154 UTSW 17 25168341 missense probably damaging 1.00
R5179:Ccdc154 UTSW 17 25171163 missense probably benign 0.43
R5709:Ccdc154 UTSW 17 25170144 missense probably damaging 1.00
R5852:Ccdc154 UTSW 17 25163209 missense probably benign
R5886:Ccdc154 UTSW 17 25171818 missense probably benign
R6191:Ccdc154 UTSW 17 25167971 missense probably damaging 1.00
R7101:Ccdc154 UTSW 17 25163468 missense probably benign 0.00
R7888:Ccdc154 UTSW 17 25164604 missense possibly damaging 0.94
R7896:Ccdc154 UTSW 17 25171826 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGTCCCTTTCCGGTAGCAC -3'
(R):5'- TGCAGATCTAGCCTCCAGCTCAG -3'

Sequencing Primer
(F):5'- CTCTGGTCCACAGGATCAC -3'
(R):5'- CTCAGAGCTAGACAGTGGTC -3'
Posted On2013-07-11