Incidental Mutation 'R7273:Uggt1'
ID565382
Institutional Source Beutler Lab
Gene Symbol Uggt1
Ensembl Gene ENSMUSG00000037470
Gene NameUDP-glucose glycoprotein glucosyltransferase 1
SynonymsUgcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.640) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36140027-36244720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36162221 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1146 (I1146T)
Ref Sequence ENSEMBL: ENSMUSP00000037930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]
Predicted Effect probably damaging
Transcript: ENSMUST00000046875
AA Change: I1146T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: I1146T

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:UDP-g_GGTase 44 1222 N/A PFAM
SCOP:d1ga8a_ 1256 1521 3e-45 SMART
Blast:BROMO 1414 1453 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173166
Predicted Effect probably benign
Transcript: ENSMUST00000174224
Predicted Effect probably benign
Transcript: ENSMUST00000174266
SMART Domains Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Uggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Uggt1 APN 1 36179552 splice site probably benign
IGL00817:Uggt1 APN 1 36185932 missense probably benign 0.03
IGL01395:Uggt1 APN 1 36155077 missense probably damaging 1.00
IGL01609:Uggt1 APN 1 36182474 missense probably damaging 1.00
IGL01619:Uggt1 APN 1 36161694 missense probably damaging 0.99
IGL02077:Uggt1 APN 1 36176794 missense probably damaging 0.99
IGL02313:Uggt1 APN 1 36184484 missense probably damaging 0.99
IGL02341:Uggt1 APN 1 36164519 makesense probably null
IGL02346:Uggt1 APN 1 36179670 missense probably benign 0.00
IGL02447:Uggt1 APN 1 36150142 missense probably damaging 1.00
IGL02883:Uggt1 APN 1 36177615 missense probably benign 0.03
IGL02930:Uggt1 APN 1 36157456 missense probably benign 0.01
IGL03153:Uggt1 APN 1 36202818 missense possibly damaging 0.94
IGL03162:Uggt1 APN 1 36207956 missense probably damaging 1.00
IGL03170:Uggt1 APN 1 36163261 missense probably damaging 1.00
IGL03266:Uggt1 APN 1 36150048 missense probably damaging 1.00
K3955:Uggt1 UTSW 1 36162353 missense probably benign 0.37
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0037:Uggt1 UTSW 1 36185932 missense probably benign 0.03
R0167:Uggt1 UTSW 1 36170197 critical splice donor site probably null
R0373:Uggt1 UTSW 1 36179670 missense probably benign 0.00
R0502:Uggt1 UTSW 1 36159946 missense probably damaging 1.00
R0546:Uggt1 UTSW 1 36195971 missense probably benign 0.00
R0610:Uggt1 UTSW 1 36165506 splice site probably benign
R0671:Uggt1 UTSW 1 36155128 missense probably damaging 1.00
R0760:Uggt1 UTSW 1 36161724 missense possibly damaging 0.68
R0825:Uggt1 UTSW 1 36158143 missense probably benign 0.01
R0827:Uggt1 UTSW 1 36156313 critical splice acceptor site probably null
R0884:Uggt1 UTSW 1 36175078 missense probably benign 0.00
R1112:Uggt1 UTSW 1 36173546 missense possibly damaging 0.54
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1470:Uggt1 UTSW 1 36176796 missense probably benign 0.13
R1592:Uggt1 UTSW 1 36202858 missense probably benign 0.04
R1730:Uggt1 UTSW 1 36221261 missense probably benign 0.05
R1923:Uggt1 UTSW 1 36179613 missense probably damaging 0.99
R1970:Uggt1 UTSW 1 36151781 missense probably damaging 1.00
R2086:Uggt1 UTSW 1 36192414 missense probably null 1.00
R2829:Uggt1 UTSW 1 36162294 missense probably benign 0.38
R3431:Uggt1 UTSW 1 36210059 nonsense probably null
R3432:Uggt1 UTSW 1 36210059 nonsense probably null
R3725:Uggt1 UTSW 1 36182507 nonsense probably null
R3880:Uggt1 UTSW 1 36176804 intron probably benign
R4052:Uggt1 UTSW 1 36164489 missense probably damaging 0.98
R4133:Uggt1 UTSW 1 36158159 missense probably damaging 1.00
R4489:Uggt1 UTSW 1 36146668 nonsense probably null
R4570:Uggt1 UTSW 1 36150073 missense probably damaging 1.00
R4866:Uggt1 UTSW 1 36202855 nonsense probably null
R4895:Uggt1 UTSW 1 36156264 missense probably damaging 1.00
R4900:Uggt1 UTSW 1 36202855 nonsense probably null
R5372:Uggt1 UTSW 1 36244060 splice site probably benign
R5385:Uggt1 UTSW 1 36184412 missense probably damaging 1.00
R5652:Uggt1 UTSW 1 36216153 nonsense probably null
R5694:Uggt1 UTSW 1 36179656 missense probably damaging 1.00
R5732:Uggt1 UTSW 1 36161771 splice site probably null
R5893:Uggt1 UTSW 1 36227628 splice site probably null
R6191:Uggt1 UTSW 1 36162208 missense probably damaging 0.98
R6247:Uggt1 UTSW 1 36163228 missense probably damaging 1.00
R6259:Uggt1 UTSW 1 36234916 missense probably benign 0.00
R6399:Uggt1 UTSW 1 36163366 missense possibly damaging 0.90
R6439:Uggt1 UTSW 1 36174951 missense possibly damaging 0.95
R6468:Uggt1 UTSW 1 36173450 missense probably benign 0.00
R6788:Uggt1 UTSW 1 36230688 missense probably benign 0.00
R7165:Uggt1 UTSW 1 36155107 missense probably benign 0.41
R7255:Uggt1 UTSW 1 36146106 missense probably damaging 1.00
R7469:Uggt1 UTSW 1 36151733 missense probably damaging 1.00
R7490:Uggt1 UTSW 1 36164508 missense probably benign 0.01
R7570:Uggt1 UTSW 1 36185838 missense probably benign 0.09
R7612:Uggt1 UTSW 1 36163235 missense probably damaging 0.99
R7759:Uggt1 UTSW 1 36146725 missense possibly damaging 0.81
R7792:Uggt1 UTSW 1 36207984 missense probably damaging 1.00
R7816:Uggt1 UTSW 1 36163315 missense possibly damaging 0.95
R7858:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7887:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R7941:Uggt1 UTSW 1 36156258 missense probably damaging 1.00
R7970:Uggt1 UTSW 1 36208034 missense probably damaging 0.99
R8040:Uggt1 UTSW 1 36211473 missense possibly damaging 0.70
X0022:Uggt1 UTSW 1 36165555 missense possibly damaging 0.67
Z1088:Uggt1 UTSW 1 36174191 missense probably damaging 1.00
Z1176:Uggt1 UTSW 1 36161695 missense probably damaging 1.00
Z1177:Uggt1 UTSW 1 36155073 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTCTCATGAACTAGGTACTG -3'
(R):5'- GTCATGTGCTTTAACTCTGGTC -3'

Sequencing Primer
(F):5'- CTCTCATGAACTAGGTACTGAACTC -3'
(R):5'- AACTCTGGTCTTTCAGGTGGACAG -3'
Posted On2019-06-26