Incidental Mutation 'R7273:Prdm16'
ID565393
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154345453 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 353 (L353P)
Ref Sequence ENSEMBL: ENSMUSP00000101263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000181143]
Predicted Effect probably damaging
Transcript: ENSMUST00000030902
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: L353P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070313
AA Change: L354P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: L354P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097759
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: L353P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105636
AA Change: L354P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: L354P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105637
AA Change: L352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: L352P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105638
AA Change: L353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: L353P

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Predicted Effect probably benign
Transcript: ENSMUST00000181143
SMART Domains Protein: ENSMUSP00000138001
Gene: ENSMUSG00000097871

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4557:Prdm16 UTSW 4 154528827 missense probably benign 0.01
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4627:Prdm16 UTSW 4 154367240 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5152:Prdm16 UTSW 4 154346102 missense probably damaging 0.99
R5257:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5368:Prdm16 UTSW 4 154345391 missense probably damaging 1.00
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
R7641:Prdm16 UTSW 4 154345444 missense probably damaging 1.00
R7704:Prdm16 UTSW 4 154341490 missense probably damaging 1.00
R7751:Prdm16 UTSW 4 154328299 missense probably damaging 1.00
R8048:Prdm16 UTSW 4 154320882 missense probably damaging 1.00
RF008:Prdm16 UTSW 4 154341995 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Z1176:Prdm16 UTSW 4 154341786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACGGCGTGGTGTCACATTC -3'
(R):5'- TGCTAAGGCCCTCTGGTAATAAC -3'

Sequencing Primer
(F):5'- GTGTCACATTCCCTCTACCAAACTAG -3'
(R):5'- CTACTACAGCAAGAGGTATCCTGG -3'
Posted On2019-06-26