Incidental Mutation 'R7273:Tmprss11d'
ID565395
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86337239 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 102 (V102D)
Ref Sequence ENSEMBL: ENSMUSP00000031175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175]
PDB Structure
Crystal structure of SEA domain of transmembrane protease from Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031175
AA Change: V102D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: V102D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
R7627:Tmprss11d UTSW 5 86309506 missense possibly damaging 0.73
R7742:Tmprss11d UTSW 5 86303634 missense probably damaging 0.98
R7937:Tmprss11d UTSW 5 86309490 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATATGGCTCCATTACTGTCCC -3'
(R):5'- AACGAAGCTGACCTCACCTG -3'

Sequencing Primer
(F):5'- CTCCCATTAAGAATGAAGTGATATGG -3'
(R):5'- GAAGCTGACCTCACCTGATAGATTTC -3'
Posted On2019-06-26