Incidental Mutation 'R7273:Smim4'
ID565416
Institutional Source Beutler Lab
Gene Symbol Smim4
Ensembl Gene ENSMUSG00000058351
Gene Namesmall integral membrane protein 4
Synonyms2010107H07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31088132-31128956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31124598 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 55 (R55S)
Ref Sequence ENSEMBL: ENSMUSP00000050634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000049732] [ENSMUST00000064032] [ENSMUST00000090205] [ENSMUST00000090214] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000203261]
Predicted Effect probably benign
Transcript: ENSMUST00000022471
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049732
AA Change: R55S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050634
Gene: ENSMUSG00000058351
AA Change: R55S

DomainStartEndE-ValueType
Pfam:UPF0640 1 69 4.6e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064032
AA Change: R55S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067418
Gene: ENSMUSG00000058351
AA Change: R55S

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090205
SMART Domains Protein: ENSMUSP00000087673
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 1 59 4.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090214
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203261
SMART Domains Protein: ENSMUSP00000145018
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Meta Mutation Damage Score 0.2029 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype NO_PHENOTYPE,Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta.
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Smim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Smim4 APN 14 31088922 intron probably benign
R0751:Smim4 UTSW 14 31088996 intron probably benign
R5737:Smim4 UTSW 14 31128719 missense probably benign 0.02
R5814:Smim4 UTSW 14 31124520 critical splice donor site probably null
R7358:Smim4 UTSW 14 31124603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGAGTCCCTTGAAAGAG -3'
(R):5'- ACCCTGTTATCTCAGACTCAAC -3'

Sequencing Primer
(F):5'- CCTTGAAAGAGTATGATCTTAGTGGC -3'
(R):5'- CTCAGCAGTTAAGTGCACTGGATC -3'
Posted On2019-06-26