Incidental Mutation 'R7273:Zhx2'
ID565420
Institutional Source Beutler Lab
Gene Symbol Zhx2
Ensembl Gene ENSMUSG00000071757
Gene Namezinc fingers and homeoboxes 2
SynonymsAfr1, Raf, Afr-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location57694665-57839832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57823428 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 731 (A731V)
Ref Sequence ENSEMBL: ENSMUSP00000094164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096430]
Predicted Effect probably benign
Transcript: ENSMUST00000096430
AA Change: A731V

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: A731V

DomainStartEndE-ValueType
ZnF_C2H2 78 101 1.79e-2 SMART
ZnF_C2H2 110 133 1.99e0 SMART
low complexity region 191 209 N/A INTRINSIC
HOX 263 324 2.11e-3 SMART
HOX 439 501 4.94e-8 SMART
HOX 530 591 2.8e-7 SMART
HOX 628 690 3.09e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Other mutations in Zhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Zhx2 APN 15 57822870 missense probably damaging 1.00
IGL00694:Zhx2 APN 15 57821760 missense probably benign
IGL02407:Zhx2 APN 15 57823406 missense probably benign 0.00
IGL02456:Zhx2 APN 15 57823639 missense possibly damaging 0.72
IGL02737:Zhx2 APN 15 57822267 missense probably damaging 1.00
IGL03050:Zhx2 UTSW 15 57822833 missense possibly damaging 0.90
R0010:Zhx2 UTSW 15 57821274 missense possibly damaging 0.92
R0105:Zhx2 UTSW 15 57822695 missense probably damaging 1.00
R0420:Zhx2 UTSW 15 57821840 missense probably damaging 1.00
R0799:Zhx2 UTSW 15 57821313 missense probably benign
R0800:Zhx2 UTSW 15 57822728 missense probably damaging 1.00
R2273:Zhx2 UTSW 15 57823169 missense probably benign 0.30
R2497:Zhx2 UTSW 15 57823155 missense possibly damaging 0.48
R4198:Zhx2 UTSW 15 57821729 missense probably benign
R4372:Zhx2 UTSW 15 57823301 missense probably benign 0.02
R4992:Zhx2 UTSW 15 57823587 missense probably damaging 0.96
R4994:Zhx2 UTSW 15 57821359 missense probably benign 0.03
R5085:Zhx2 UTSW 15 57822693 missense probably damaging 1.00
R5141:Zhx2 UTSW 15 57821786 missense probably benign 0.00
R5470:Zhx2 UTSW 15 57823074 missense possibly damaging 0.76
R5659:Zhx2 UTSW 15 57822308 missense probably benign
R5710:Zhx2 UTSW 15 57821470 nonsense probably null
R6171:Zhx2 UTSW 15 57823206 missense probably damaging 1.00
R7181:Zhx2 UTSW 15 57823350 missense probably benign
R7215:Zhx2 UTSW 15 57823643 missense probably benign
R7575:Zhx2 UTSW 15 57823262 missense probably damaging 1.00
R7662:Zhx2 UTSW 15 57822176 missense probably damaging 1.00
R7883:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
R7966:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCAGTTAGCTGCCAAGACCG -3'
(R):5'- AAAGTCCACGATGCCTGACTC -3'

Sequencing Primer
(F):5'- TCCGAACTGAGATTGTGCGC -3'
(R):5'- ACGATGCCTGACTCCTCGTTC -3'
Posted On2019-06-26