Incidental Mutation 'R7273:Top1mt'
ID565421
Institutional Source Beutler Lab
Gene Symbol Top1mt
Ensembl Gene ENSMUSG00000000934
Gene NameDNA topoisomerase 1, mitochondrial
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location75657035-75678800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75664082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 457 (V457A)
Ref Sequence ENSEMBL: ENSMUSP00000000958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000958]
Predicted Effect probably benign
Transcript: ENSMUST00000000958
AA Change: V457A

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000958
Gene: ENSMUSG00000000934
AA Change: V457A

DomainStartEndE-ValueType
Blast:TOPEUc 72 150 4e-38 BLAST
low complexity region 151 166 N/A INTRINSIC
TOPEUc 189 565 5.86e-230 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA topoisomerase that plays a role in the modification of DNA topology. The encoded protein is a type IB topoisomerase and catalyzes the transient breaking and rejoining of DNA to relieve tension and DNA supercoiling generated in the mitochondrial genome during replication and transcription. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display increased oxidative stress and lipid peroxidation, enhanced glycolysis, and mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il1r2 A G 1: 40,112,007 T141A probably benign Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Top1mt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Top1mt APN 15 75657143 missense possibly damaging 0.47
IGL02111:Top1mt APN 15 75665706 splice site probably benign
IGL02425:Top1mt APN 15 75676121 missense probably benign
IGL02662:Top1mt APN 15 75668705 missense probably damaging 1.00
R1240:Top1mt UTSW 15 75670067 missense probably damaging 0.99
R1438:Top1mt UTSW 15 75674398 missense probably damaging 1.00
R1732:Top1mt UTSW 15 75666251 critical splice donor site probably null
R1884:Top1mt UTSW 15 75667901 missense possibly damaging 0.81
R3413:Top1mt UTSW 15 75657176 missense probably benign 0.41
R3414:Top1mt UTSW 15 75657176 missense probably benign 0.41
R4677:Top1mt UTSW 15 75664058 missense possibly damaging 0.48
R4784:Top1mt UTSW 15 75657703 missense probably damaging 1.00
R4784:Top1mt UTSW 15 75676031 missense possibly damaging 0.88
R4791:Top1mt UTSW 15 75668625 critical splice donor site probably null
R6339:Top1mt UTSW 15 75665656 missense possibly damaging 0.72
R6723:Top1mt UTSW 15 75667433 missense probably benign 0.01
R6732:Top1mt UTSW 15 75669488 splice site probably null
R6841:Top1mt UTSW 15 75676124 missense probably benign 0.00
R6884:Top1mt UTSW 15 75664044 missense probably benign 0.37
R7024:Top1mt UTSW 15 75667448 missense probably damaging 1.00
R7052:Top1mt UTSW 15 75668711 missense possibly damaging 0.82
R7055:Top1mt UTSW 15 75678674 missense probably benign 0.01
R8032:Top1mt UTSW 15 75668723 missense probably damaging 1.00
X0028:Top1mt UTSW 15 75657131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTGATTCCAAGTCCCCG -3'
(R):5'- AGGTCACTGACTTCTTCCTTGG -3'

Sequencing Primer
(F):5'- GCCTCCTACAGCACTATACCCAG -3'
(R):5'- GTTGTAGTCCAGCGTACAACACTTG -3'
Posted On2019-06-26