Incidental Mutation 'R7274:Ttc39b'
ID565441
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7274 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83261851 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 132 (K132E)
Ref Sequence ENSEMBL: ENSMUSP00000099887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030205] [ENSMUST00000048274] [ENSMUST00000102823] [ENSMUST00000148811] [ENSMUST00000150522]
Predicted Effect probably damaging
Transcript: ENSMUST00000030205
AA Change: K132E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030205
Gene: ENSMUSG00000038172
AA Change: K132E

DomainStartEndE-ValueType
Pfam:DUF3808 75 173 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048274
AA Change: K132E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040590
Gene: ENSMUSG00000038172
AA Change: K132E

DomainStartEndE-ValueType
Pfam:DUF3808 75 478 2.2e-147 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102823
AA Change: K132E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172
AA Change: K132E

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148811
AA Change: K102E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124490
Gene: ENSMUSG00000038172
AA Change: K102E

DomainStartEndE-ValueType
Pfam:DUF3808 45 143 9.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150522
AA Change: K102E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124955
Gene: ENSMUSG00000038172
AA Change: K102E

DomainStartEndE-ValueType
Pfam:DUF3808 45 179 1.6e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cog2 T G 8: 124,535,519 S299A possibly damaging Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Kif19a G T 11: 114,765,455 probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Nubpl A G 12: 52,132,420 probably benign Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Polr1a T A 6: 71,920,516 C205* probably null Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Rassf8 T C 6: 145,815,569 V207A probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Sptlc2 A T 12: 87,341,606 D367E probably benign Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Tkt T A 14: 30,569,145 probably null Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0536:Ttc39b UTSW 4 83227198 missense probably damaging 1.00
R0654:Ttc39b UTSW 4 83241701 missense probably benign 0.03
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5360:Ttc39b UTSW 4 83261847 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R6873:Ttc39b UTSW 4 83246276 missense probably damaging 1.00
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
R7536:Ttc39b UTSW 4 83239978 nonsense probably null
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCACTGCATAGAACGGAACTG -3'
(R):5'- ACACGGTGAGGATTAGGTATTG -3'

Sequencing Primer
(F):5'- CTGCATAGAACGGAACTGTCCAAG -3'
(R):5'- TGAGGATTAGGTATTGTTGGTATCAG -3'
Posted On2019-06-26