Incidental Mutation 'R7274:Polr1a'
ID565446
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7274 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71920516 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 205 (C205*)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect probably null
Transcript: ENSMUST00000055296
AA Change: C205*
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: C205*

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000206556
AA Change: C205*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cog2 T G 8: 124,535,519 S299A possibly damaging Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Kif19a G T 11: 114,765,455 probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Nubpl A G 12: 52,132,420 probably benign Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Rassf8 T C 6: 145,815,569 V207A probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Sptlc2 A T 12: 87,341,606 D367E probably benign Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Tkt T A 14: 30,569,145 probably null Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttc39b T C 4: 83,261,851 K132E possibly damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8745:Polr1a UTSW 6 71954771 missense probably damaging 1.00
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTCTTCAGAGCAGCACTC -3'
(R):5'- GATTTCTTGTGCACCGTGGC -3'

Sequencing Primer
(F):5'- ATAATCCCGTTTCGTGAGAGGC -3'
(R):5'- CACCGTGGCTGGGTATG -3'
Posted On2019-06-26