Incidental Mutation 'R7274:Rassf8'
ID565449
Institutional Source Beutler Lab
Gene Symbol Rassf8
Ensembl Gene ENSMUSG00000030259
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms5133400D11Rik, mHoj-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R7274 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location145746748-145821079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145815569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000032388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]
Predicted Effect probably benign
Transcript: ENSMUST00000032388
AA Change: V207A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: V207A

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058538
Predicted Effect probably benign
Transcript: ENSMUST00000111704
AA Change: V207A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: V207A

DomainStartEndE-ValueType
RA 1 82 4.17e-11 SMART
coiled coil region 161 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140966
SMART Domains Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

DomainStartEndE-ValueType
RA 1 80 7.85e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cog2 T G 8: 124,535,519 S299A possibly damaging Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Kif19a G T 11: 114,765,455 probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Nubpl A G 12: 52,132,420 probably benign Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Polr1a T A 6: 71,920,516 C205* probably null Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Sptlc2 A T 12: 87,341,606 D367E probably benign Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Tkt T A 14: 30,569,145 probably null Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttc39b T C 4: 83,261,851 K132E possibly damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Rassf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02973:Rassf8 APN 6 145817190 unclassified probably benign
IGL03017:Rassf8 APN 6 145817198 splice site probably null
IGL03091:Rassf8 APN 6 145815810 missense probably benign 0.00
R0230:Rassf8 UTSW 6 145819974 unclassified probably benign
R0967:Rassf8 UTSW 6 145819950 unclassified probably benign
R1429:Rassf8 UTSW 6 145815190 missense probably damaging 1.00
R1622:Rassf8 UTSW 6 145820103 unclassified probably benign
R1738:Rassf8 UTSW 6 145815308 missense probably benign 0.03
R1894:Rassf8 UTSW 6 145808473 missense probably damaging 1.00
R2126:Rassf8 UTSW 6 145815182 missense probably benign 0.00
R2238:Rassf8 UTSW 6 145817184 missense probably damaging 1.00
R2439:Rassf8 UTSW 6 145815334 missense probably damaging 1.00
R3699:Rassf8 UTSW 6 145820076 unclassified probably benign
R4678:Rassf8 UTSW 6 145815082 missense probably damaging 1.00
R4734:Rassf8 UTSW 6 145815540 missense probably benign 0.34
R4826:Rassf8 UTSW 6 145816550 missense probably damaging 1.00
R4910:Rassf8 UTSW 6 145815280 nonsense probably null
R4988:Rassf8 UTSW 6 145817144 missense possibly damaging 0.89
R5425:Rassf8 UTSW 6 145815542 missense probably benign
R5620:Rassf8 UTSW 6 145820181 unclassified probably benign
R5747:Rassf8 UTSW 6 145815815 missense probably benign 0.00
R6136:Rassf8 UTSW 6 145815656 missense probably benign 0.00
R6220:Rassf8 UTSW 6 145817133 missense probably damaging 1.00
R7315:Rassf8 UTSW 6 145815751 missense probably benign
R7480:Rassf8 UTSW 6 145820031 missense unknown
R7593:Rassf8 UTSW 6 145815403 missense probably benign 0.08
R7714:Rassf8 UTSW 6 145815247 missense probably damaging 0.98
R7962:Rassf8 UTSW 6 145815943 critical splice donor site probably null
R8222:Rassf8 UTSW 6 145820057 missense unknown
R8374:Rassf8 UTSW 6 145815137 nonsense probably null
R8409:Rassf8 UTSW 6 145815703 missense probably benign
Z1088:Rassf8 UTSW 6 145815482 missense probably benign
Z1088:Rassf8 UTSW 6 145816616 missense probably benign 0.41
Z1176:Rassf8 UTSW 6 145816642 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCTCACCTTCACAGGG -3'
(R):5'- ATTGACCTGTGCCTCCTGAAC -3'

Sequencing Primer
(F):5'- CAAAGGGCTGACGGACATTTTTG -3'
(R):5'- CAGTTTTTCTGCCTGGAGACCG -3'
Posted On2019-06-26