Incidental Mutation 'R0584:Nop58'
ID56545
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene NameNOP58 ribonucleoprotein
SynonymsMSSP, SIK similar protein, Nol5
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R0584 (G1)
Quality Score132
Status Validated
Chromosome1
Chromosomal Location59684971-59719044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59706760 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 400 (D400G)
Ref Sequence ENSEMBL: ENSMUSP00000140250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000190265] [ENSMUST00000191142]
Predicted Effect probably benign
Transcript: ENSMUST00000027174
AA Change: D400G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020
AA Change: D400G

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185368
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect probably benign
Transcript: ENSMUST00000187837
Predicted Effect unknown
Transcript: ENSMUST00000188390
AA Change: D111G
Predicted Effect probably benign
Transcript: ENSMUST00000189919
Predicted Effect probably benign
Transcript: ENSMUST00000190265
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191142
AA Change: D400G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020
AA Change: D400G

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59704083 missense probably damaging 0.98
R1170:Nop58 UTSW 1 59704211 splice site probably benign
R1177:Nop58 UTSW 1 59700932 missense probably damaging 1.00
R1485:Nop58 UTSW 1 59698345 missense probably damaging 0.98
R1588:Nop58 UTSW 1 59702872 missense probably damaging 1.00
R4715:Nop58 UTSW 1 59696026 missense probably benign 0.00
R5611:Nop58 UTSW 1 59710513 unclassified probably benign
R5933:Nop58 UTSW 1 59704665 nonsense probably null
R5979:Nop58 UTSW 1 59702831 missense probably damaging 1.00
R6010:Nop58 UTSW 1 59700912 missense probably damaging 1.00
R6244:Nop58 UTSW 1 59702855 missense probably damaging 1.00
R6371:Nop58 UTSW 1 59711312 unclassified probably benign
R7210:Nop58 UTSW 1 59710380 intron probably null
R7337:Nop58 UTSW 1 59698440 missense probably benign 0.00
R7582:Nop58 UTSW 1 59700938 missense probably damaging 0.99
R7704:Nop58 UTSW 1 59705595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAAAGAATCAATGCTGCCTCTCAT -3'
(R):5'- GTCCATACTGCTGTGTCTCAAGTTTACA -3'

Sequencing Primer
(F):5'- GAATCAATGCTGCCTCTCATTTTATG -3'
(R):5'- GTAACACATCTTCTACTGCATATAGC -3'
Posted On2013-07-11