Incidental Mutation 'R7274:Cog2'
ID565458
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7274 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124535519 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 299 (S299A)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034460
AA Change: S299A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: S299A

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Kif19a G T 11: 114,765,455 probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Nubpl A G 12: 52,132,420 probably benign Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Polr1a T A 6: 71,920,516 C205* probably null Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Rassf8 T C 6: 145,815,569 V207A probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Sptlc2 A T 12: 87,341,606 D367E probably benign Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Tkt T A 14: 30,569,145 probably null Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttc39b T C 4: 83,261,851 K132E possibly damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7641:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCGAGCAGTTTCCGTTTGTC -3'
(R):5'- TACAGAATGGGATGTGGGCC -3'

Sequencing Primer
(F):5'- CTGTCTGTAGGTGATGTCGAGCAG -3'
(R):5'- TGGGCCATGAAAGAATGAACTCTC -3'
Posted On2019-06-26