Mutagenetix > Incidental Mutation

Incidental Mutation 'R7274:Cog2'

565458

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7274 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 124535519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 299 (S299A)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034460
AA Change: S299A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: S299A

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190005I06Rik	T	C	8: 120,611,266	S69G	possibly damaging	Het
Alg12	G	A	15: 88,806,707	S337F	probably damaging	Het
Bcl11a	T	C	11: 24,163,985	S443P	probably damaging	Het
C1qtnf4	T	C	2: 90,889,541	Y53H	probably damaging	Het
Cacna1d	T	A	14: 30,142,643	E454V	probably damaging	Het
Cacna1h	A	G	17: 25,378,837	F1761S	probably damaging	Het
Cacna1i	A	T	15: 80,376,822	I1344F	possibly damaging	Het
Cat	T	C	2: 103,476,890	N33D	probably benign	Het
Cdh17	C	T	4: 11,783,174	Q172*	probably null	Het
Chrna2	A	G	14: 66,149,226	I274V	probably benign	Het
Cpa6	C	A	1: 10,409,299	M236I	probably damaging	Het
Crym	T	A	7: 120,190,519	Q242L	probably benign	Het
Ddx60	T	C	8: 61,940,108		probably null	Het
Epdr1	A	T	13: 19,593,288	I180N	possibly damaging	Het
Fancd2os	G	A	6: 113,597,890	L52F	probably benign	Het
Fbxo16	C	A	14: 65,321,267	R292S	probably benign	Het
Fn1	T	C	1: 71,628,113	Q820R	probably benign	Het
Gm4131	T	A	14: 62,466,852	Y140F	possibly damaging	Het
Gm8994	A	G	6: 136,329,398	T286A	possibly damaging	Het
Grin2a	T	C	16: 9,579,122	R1034G	possibly damaging	Het
Hypk	A	G	2: 121,454,324		probably benign	Het
Ighmbp2	A	G	19: 3,264,951	V823A	probably benign	Het
Irf5	A	G	6: 29,534,040	N95S	probably damaging	Het
Kdr	A	T	5: 75,964,700	M379K	probably benign	Het
Kif19a	G	T	11: 114,765,455		probably benign	Het
Klhdc4	T	C	8: 121,799,658		probably null	Het
Lama2	A	T	10: 27,119,980	I1717N	probably damaging	Het
Lama4	A	T	10: 39,092,299	Q1479L	probably benign	Het
Lgr5	T	A	10: 115,452,505	T745S	probably damaging	Het
Lifr	T	A	15: 7,167,059		probably null	Het
Llgl1	C	T	11: 60,705,986	R138C	possibly damaging	Het
Mccc1	A	T	3: 35,989,856	V246E	probably damaging	Het
Mdn1	T	A	4: 32,725,944	L2621H	probably benign	Het
Mecr	C	A	4: 131,853,778	A80D	probably damaging	Het
Mia2	A	G	12: 59,108,119	E206G	probably damaging	Het
Nubpl	A	G	12: 52,132,420		probably benign	Het
Obscn	C	T	11: 59,133,227	R539H	probably damaging	Het
Olfr1100	A	G	2: 86,978,523	V91A	probably benign	Het
Olfr733	T	A	14: 50,298,422	T296S	probably benign	Het
Pde5a	A	T	3: 122,855,246	K838*	probably null	Het
Pgm3	A	G	9: 86,562,597	L295P	probably damaging	Het
Pkp2	T	C	16: 16,246,929	L439P	possibly damaging	Het
Polr1a	T	A	6: 71,920,516	C205*	probably null	Het
Rab3gap1	T	A	1: 127,927,512	I429K	probably benign	Het
Rassf8	T	C	6: 145,815,569	V207A	probably benign	Het
Sacs	T	A	14: 61,214,081	D4525E	possibly damaging	Het
Sec24a	A	T	11: 51,707,255	L864Q	probably damaging	Het
Spats2l	C	A	1: 57,879,513	Y35*	probably null	Het
Sptlc2	A	T	12: 87,341,606	D367E	probably benign	Het
Ssc4d	T	C	5: 135,967,956	D97G	possibly damaging	Het
Tjp1	A	G	7: 65,527,652	Y3H	possibly damaging	Het
Tkt	T	A	14: 30,569,145		probably null	Het
Trim60	T	A	8: 65,000,481	N372I	possibly damaging	Het
Trpm2	T	C	10: 77,923,555	N1132D	probably benign	Het
Tsc22d1	T	C	14: 76,416,714	I211T	probably damaging	Het
Ttc39b	T	C	4: 83,261,851	K132E	possibly damaging	Het
Ttn	C	T	2: 76,723,588	V30924I	probably damaging	Het
Tubgcp6	G	A	15: 89,102,970	Q1267*	probably null	Het
Zfp30	C	A	7: 29,792,618	T180N	probably benign	Het
Zp2	A	G	7: 120,132,391	*714R	probably null	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TCGAGCAGTTTCCGTTTGTC -3'
(R):5'- TACAGAATGGGATGTGGGCC -3'

Sequencing Primer
(F):5'- CTGTCTGTAGGTGATGTCGAGCAG -3'
(R):5'- TGGGCCATGAAAGAATGAACTCTC -3'

Posted On

2019-06-26