Incidental Mutation 'R7274:Kif19a'
ID565469
Institutional Source Beutler Lab
Gene Symbol Kif19a
Ensembl Gene ENSMUSG00000010021
Gene Namekinesin family member 19A
SynonymsN-8 kinesin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7274 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location114765388-114790739 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 114765455 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084368] [ENSMUST00000138804]
Predicted Effect probably benign
Transcript: ENSMUST00000084368
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138804
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality, hydroencephaly, female infertility, oviduct obstruction, increased motile cilium length and impaired motile cilium movement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cog2 T G 8: 124,535,519 S299A possibly damaging Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Polr1a T A 6: 71,920,516 C205* probably null Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Rassf8 T C 6: 145,815,569 V207A probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Sptlc2 A T 12: 87,341,606 D367E probably benign Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttc39b T C 4: 83,261,851 K132E possibly damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Kif19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Kif19a APN 11 114779585 missense probably damaging 1.00
IGL00743:Kif19a APN 11 114784773 missense probably damaging 1.00
IGL00763:Kif19a APN 11 114767168 missense probably benign 0.00
IGL01327:Kif19a APN 11 114781799 splice site probably benign
IGL02422:Kif19a APN 11 114789361 missense probably damaging 1.00
IGL02481:Kif19a APN 11 114789153 missense probably benign 0.28
IGL02496:Kif19a APN 11 114779644 missense probably damaging 0.99
IGL02735:Kif19a APN 11 114785567 missense probably damaging 1.00
IGL02830:Kif19a APN 11 114781208 missense probably damaging 1.00
IGL02902:Kif19a APN 11 114785570 missense possibly damaging 0.46
IGL03372:Kif19a APN 11 114779218 missense probably damaging 0.99
PIT4520001:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R0212:Kif19a UTSW 11 114784910 missense possibly damaging 0.48
R0383:Kif19a UTSW 11 114765514 start codon destroyed possibly damaging 0.63
R0850:Kif19a UTSW 11 114780787 missense probably damaging 0.99
R1343:Kif19a UTSW 11 114785827 missense probably benign 0.08
R1422:Kif19a UTSW 11 114785809 missense probably benign 0.01
R1547:Kif19a UTSW 11 114786572 missense probably benign 0.41
R1591:Kif19a UTSW 11 114789231 missense probably benign
R2148:Kif19a UTSW 11 114780768 missense probably damaging 1.00
R2291:Kif19a UTSW 11 114790193 missense probably damaging 1.00
R3814:Kif19a UTSW 11 114781919 missense probably damaging 1.00
R3944:Kif19a UTSW 11 114786735 missense probably benign 0.34
R4631:Kif19a UTSW 11 114784847 missense possibly damaging 0.95
R4866:Kif19a UTSW 11 114767227 missense probably benign 0.00
R4867:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5022:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5071:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5072:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5073:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5074:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5091:Kif19a UTSW 11 114783097 missense probably damaging 1.00
R5640:Kif19a UTSW 11 114779215 missense probably benign 0.25
R5646:Kif19a UTSW 11 114779654 missense probably damaging 1.00
R5786:Kif19a UTSW 11 114779223 nonsense probably null
R5890:Kif19a UTSW 11 114789438 missense possibly damaging 0.92
R6344:Kif19a UTSW 11 114781951 critical splice donor site probably null
R6522:Kif19a UTSW 11 114785779 missense probably damaging 1.00
R6570:Kif19a UTSW 11 114784905 missense possibly damaging 0.63
R6879:Kif19a UTSW 11 114781333 missense probably benign 0.03
R7028:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R7492:Kif19a UTSW 11 114790239 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGCTCACCAAAGTTCAGGG -3'
(R):5'- TTGTTCTGCACAGTCCCAGAC -3'

Sequencing Primer
(F):5'- TCACCAAAGTTCAGGGGGCAG -3'
(R):5'- TTGCTCTCAGTGGTCACTATG -3'
Posted On2019-06-26