Incidental Mutation 'R7274:Sptlc2'
ID565471
Institutional Source Beutler Lab
Gene Symbol Sptlc2
Ensembl Gene ENSMUSG00000021036
Gene Nameserine palmitoyltransferase, long chain base subunit 2
SynonymsLCB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7274 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87305058-87388355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87341606 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 367 (D367E)
Ref Sequence ENSEMBL: ENSMUSP00000021424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021424]
Predicted Effect probably benign
Transcript: ENSMUST00000021424
AA Change: D367E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021424
Gene: ENSMUSG00000021036
AA Change: D367E

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 166 526 7.2e-60 PFAM
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a long chain base subunit of serine palmitoyltransferase. The enzyme, serine palmitoyltransferase, consists of two different subunits, and is the key enzyme in sphingolipid biosynthesis. It catalyzes the pyridoxal-5-prime-phosphate-dependent condensation of L-serine and palmitoyl-CoA to 3-oxosphinganine. A mutant allele of this gene in mice is used as a model for the human disease 'Susceptibilty to Psoriasis 1'. Mutations in the human gene are associated with hereditary sensory neuropathy type I. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit abnormal liver and circulating shingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik T C 8: 120,611,266 S69G possibly damaging Het
Alg12 G A 15: 88,806,707 S337F probably damaging Het
Bcl11a T C 11: 24,163,985 S443P probably damaging Het
C1qtnf4 T C 2: 90,889,541 Y53H probably damaging Het
Cacna1d T A 14: 30,142,643 E454V probably damaging Het
Cacna1h A G 17: 25,378,837 F1761S probably damaging Het
Cacna1i A T 15: 80,376,822 I1344F possibly damaging Het
Cat T C 2: 103,476,890 N33D probably benign Het
Cdh17 C T 4: 11,783,174 Q172* probably null Het
Chrna2 A G 14: 66,149,226 I274V probably benign Het
Cog2 T G 8: 124,535,519 S299A possibly damaging Het
Cpa6 C A 1: 10,409,299 M236I probably damaging Het
Crym T A 7: 120,190,519 Q242L probably benign Het
Ddx60 T C 8: 61,940,108 probably null Het
Epdr1 A T 13: 19,593,288 I180N possibly damaging Het
Fancd2os G A 6: 113,597,890 L52F probably benign Het
Fbxo16 C A 14: 65,321,267 R292S probably benign Het
Fn1 T C 1: 71,628,113 Q820R probably benign Het
Gm4131 T A 14: 62,466,852 Y140F possibly damaging Het
Gm8994 A G 6: 136,329,398 T286A possibly damaging Het
Grin2a T C 16: 9,579,122 R1034G possibly damaging Het
Hypk A G 2: 121,454,324 probably benign Het
Ighmbp2 A G 19: 3,264,951 V823A probably benign Het
Irf5 A G 6: 29,534,040 N95S probably damaging Het
Kdr A T 5: 75,964,700 M379K probably benign Het
Kif19a G T 11: 114,765,455 probably benign Het
Klhdc4 T C 8: 121,799,658 probably null Het
Lama2 A T 10: 27,119,980 I1717N probably damaging Het
Lama4 A T 10: 39,092,299 Q1479L probably benign Het
Lgr5 T A 10: 115,452,505 T745S probably damaging Het
Lifr T A 15: 7,167,059 probably null Het
Llgl1 C T 11: 60,705,986 R138C possibly damaging Het
Mccc1 A T 3: 35,989,856 V246E probably damaging Het
Mdn1 T A 4: 32,725,944 L2621H probably benign Het
Mecr C A 4: 131,853,778 A80D probably damaging Het
Mia2 A G 12: 59,108,119 E206G probably damaging Het
Nubpl A G 12: 52,132,420 probably benign Het
Obscn C T 11: 59,133,227 R539H probably damaging Het
Olfr1100 A G 2: 86,978,523 V91A probably benign Het
Olfr733 T A 14: 50,298,422 T296S probably benign Het
Pde5a A T 3: 122,855,246 K838* probably null Het
Pgm3 A G 9: 86,562,597 L295P probably damaging Het
Pkp2 T C 16: 16,246,929 L439P possibly damaging Het
Polr1a T A 6: 71,920,516 C205* probably null Het
Rab3gap1 T A 1: 127,927,512 I429K probably benign Het
Rassf8 T C 6: 145,815,569 V207A probably benign Het
Sacs T A 14: 61,214,081 D4525E possibly damaging Het
Sec24a A T 11: 51,707,255 L864Q probably damaging Het
Spats2l C A 1: 57,879,513 Y35* probably null Het
Ssc4d T C 5: 135,967,956 D97G possibly damaging Het
Tjp1 A G 7: 65,527,652 Y3H possibly damaging Het
Tkt T A 14: 30,569,145 probably null Het
Trim60 T A 8: 65,000,481 N372I possibly damaging Het
Trpm2 T C 10: 77,923,555 N1132D probably benign Het
Tsc22d1 T C 14: 76,416,714 I211T probably damaging Het
Ttc39b T C 4: 83,261,851 K132E possibly damaging Het
Ttn C T 2: 76,723,588 V30924I probably damaging Het
Tubgcp6 G A 15: 89,102,970 Q1267* probably null Het
Zfp30 C A 7: 29,792,618 T180N probably benign Het
Zp2 A G 7: 120,132,391 *714R probably null Het
Other mutations in Sptlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Sptlc2 APN 12 87369068 missense probably damaging 0.99
IGL02458:Sptlc2 APN 12 87309893 utr 3 prime probably benign
IGL02734:Sptlc2 APN 12 87355670 missense probably damaging 0.97
IGL03252:Sptlc2 APN 12 87355657 missense probably benign 0.00
lopsided UTSW 12 87341565 missense probably benign 0.27
shinola UTSW 12 87350295 missense possibly damaging 0.64
R0087:Sptlc2 UTSW 12 87369118 missense probably benign
R0116:Sptlc2 UTSW 12 87356680 missense probably benign 0.00
R0492:Sptlc2 UTSW 12 87346806 splice site probably null
R1353:Sptlc2 UTSW 12 87341746 missense probably damaging 1.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R1470:Sptlc2 UTSW 12 87355640 missense probably benign 0.00
R3417:Sptlc2 UTSW 12 87346808 splice site probably benign
R3735:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R3736:Sptlc2 UTSW 12 87341565 missense probably benign 0.27
R4278:Sptlc2 UTSW 12 87336151 missense probably benign 0.04
R5252:Sptlc2 UTSW 12 87336055 missense possibly damaging 0.49
R5593:Sptlc2 UTSW 12 87369083 missense probably benign 0.11
R5656:Sptlc2 UTSW 12 87346761 missense probably damaging 1.00
R5801:Sptlc2 UTSW 12 87341771 splice site probably null
R6256:Sptlc2 UTSW 12 87355531 missense probably damaging 1.00
R6280:Sptlc2 UTSW 12 87388131 missense probably benign
R6520:Sptlc2 UTSW 12 87355662 missense probably benign
R6808:Sptlc2 UTSW 12 87350295 missense possibly damaging 0.64
R7133:Sptlc2 UTSW 12 87350377 missense probably benign 0.00
R7366:Sptlc2 UTSW 12 87314049 critical splice donor site probably null
R7602:Sptlc2 UTSW 12 87341689 missense probably damaging 0.99
Z1177:Sptlc2 UTSW 12 87369044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATCTACATATCCCAGGGTCAGG -3'
(R):5'- CTCAAGGCATTCATAATGAGCATAG -3'

Sequencing Primer
(F):5'- GTCAGGACCCCAGCTCCAAG -3'
(R):5'- AGAGTGCTTTCCTGGCATATTCAAG -3'
Posted On2019-06-26