Incidental Mutation 'R7275:Agxt2'
ID565535
Institutional Source Beutler Lab
Gene Symbol Agxt2
Ensembl Gene ENSMUSG00000089678
Gene Namealanine-glyoxylate aminotransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7275 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location10358532-10410153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10358667 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 24 (R24H)
Ref Sequence ENSEMBL: ENSMUSP00000106171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022858] [ENSMUST00000110541] [ENSMUST00000110542]
Predicted Effect probably benign
Transcript: ENSMUST00000022858
AA Change: R24H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022858
Gene: ENSMUSG00000089678
AA Change: R24H

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 228 4.5e-36 PFAM
Pfam:Aminotran_3 269 532 5.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110541
AA Change: R24H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106170
Gene: ENSMUSG00000089678
AA Change: R24H

DomainStartEndE-ValueType
Pfam:Aminotran_3 86 219 1.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110542
AA Change: R24H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106171
Gene: ENSMUSG00000089678
AA Change: R24H

DomainStartEndE-ValueType
Pfam:Aminotran_3 87 443 1.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a class III pyridoxal-phosphate-dependent mitochondrial aminotransferase. It catalyzes the conversion of glyoxylate to glycine using L-alanine as the amino donor. It is an important regulator of methylarginines and is involved in the control of blood pressure in kidney. Polymorphisms in this gene affect methylarginine and beta-aminoisobutyrate metabolism, and are associated with carotid atherosclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit reduced circulating L-citrulline, hypertension under terminal aesthesia and increased vasodilation maximal response following acetylcholine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Gpat2 G C 2: 127,431,367 G224R possibly damaging Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Other mutations in Agxt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Agxt2 APN 15 10393708 splice site probably null
IGL02434:Agxt2 APN 15 10358600 missense possibly damaging 0.83
IGL02824:Agxt2 APN 15 10393805 missense probably null 0.96
IGL02929:Agxt2 APN 15 10388293 splice site probably benign
IGL03368:Agxt2 APN 15 10388170 nonsense probably null
PIT4810001:Agxt2 UTSW 15 10399065 missense probably benign 0.00
R0179:Agxt2 UTSW 15 10399048 missense possibly damaging 0.71
R0526:Agxt2 UTSW 15 10373862 missense probably damaging 1.00
R1085:Agxt2 UTSW 15 10388252 missense probably benign 0.00
R1173:Agxt2 UTSW 15 10373751 missense probably damaging 1.00
R1174:Agxt2 UTSW 15 10373751 missense probably damaging 1.00
R1387:Agxt2 UTSW 15 10380610 missense probably damaging 1.00
R1642:Agxt2 UTSW 15 10373831 missense probably damaging 1.00
R1938:Agxt2 UTSW 15 10391935 missense probably damaging 1.00
R3439:Agxt2 UTSW 15 10381425 missense probably benign 0.19
R4485:Agxt2 UTSW 15 10378882 missense possibly damaging 0.89
R4698:Agxt2 UTSW 15 10392044 critical splice donor site probably null
R5582:Agxt2 UTSW 15 10399159 missense probably damaging 1.00
R6056:Agxt2 UTSW 15 10378877 missense probably damaging 1.00
R6109:Agxt2 UTSW 15 10377422 missense probably damaging 1.00
R6393:Agxt2 UTSW 15 10393808 critical splice donor site probably null
R6868:Agxt2 UTSW 15 10373769 missense probably damaging 1.00
R7206:Agxt2 UTSW 15 10377456 missense probably damaging 0.99
R7475:Agxt2 UTSW 15 10409537 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGCAGTTTCCTTTCTAAAGC -3'
(R):5'- TCGACCTGAGCTTGGATGAC -3'

Sequencing Primer
(F):5'- TTTCTAAAGCCACCCCGC -3'
(R):5'- CATCAAAGTTGAGATAGCCAGTTC -3'
Posted On2019-06-26