Incidental Mutation 'R7275:Osr2'
ID565539
Institutional Source Beutler Lab
Gene Symbol Osr2
Ensembl Gene ENSMUSG00000022330
Gene Nameodd-skipped related 2
Synonyms5430409I15Rik, Osr2B, Osr2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7275 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location35296098-35303305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35300886 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 196 (D196G)
Ref Sequence ENSEMBL: ENSMUSP00000022952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022952] [ENSMUST00000228152]
Predicted Effect probably damaging
Transcript: ENSMUST00000022952
AA Change: D196G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022952
Gene: ENSMUSG00000022330
AA Change: D196G

DomainStartEndE-ValueType
low complexity region 136 153 N/A INTRINSIC
ZnF_C2H2 172 194 2.05e-2 SMART
ZnF_C2H2 200 222 2.4e-3 SMART
ZnF_C2H2 228 250 4.4e-2 SMART
low complexity region 253 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228152
AA Change: D196G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.1777 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] OSR2 is a mammalian homolog of the Drosophila odd-skipped family of transcription factors (Lan et al., 2004 [PubMed 15175245]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, cleft of the secondary palate, and thickened tympanic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Olfr936 T A 9: 39,047,519 probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc30a2 T A 4: 134,349,270 probably null Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Sulf1 T A 1: 12,850,965 probably null Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Zp2 A T 7: 120,135,353 probably null Het
Other mutations in Osr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Osr2 APN 15 35301992 missense probably damaging 1.00
IGL02627:Osr2 APN 15 35300454 missense possibly damaging 0.91
IGL03371:Osr2 APN 15 35300854 nonsense probably null
R1517:Osr2 UTSW 15 35300667 missense probably benign
R1893:Osr2 UTSW 15 35300462 missense possibly damaging 0.91
R4408:Osr2 UTSW 15 35300471 missense possibly damaging 0.88
R8157:Osr2 UTSW 15 35301917 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGCAAGAAGATCCTCCTAAAATGGG -3'
(R):5'- AAGAATGCAGCGGTCCTCAG -3'

Sequencing Primer
(F):5'- AGACCTGAGCAAGCTGAGCC -3'
(R):5'- TCAGCGAGGTTCGGAGG -3'
Posted On2019-06-26