Incidental Mutation 'R7275:Zhx1'
ID565540
Institutional Source Beutler Lab
Gene Symbol Zhx1
Ensembl Gene ENSMUSG00000022361
Gene Namezinc fingers and homeoboxes 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7275 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58047003-58076541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58054362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000066201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070143] [ENSMUST00000110168] [ENSMUST00000175805] [ENSMUST00000176076] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000177276] [ENSMUST00000177504]
Predicted Effect probably benign
Transcript: ENSMUST00000070143
AA Change: T163A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066201
Gene: ENSMUSG00000022361
AA Change: T163A

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110168
AA Change: T163A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105797
Gene: ENSMUSG00000022361
AA Change: T163A

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175805
AA Change: T163A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134844
Gene: ENSMUSG00000022361
AA Change: T163A

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176076
Predicted Effect probably benign
Transcript: ENSMUST00000176935
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect probably benign
Transcript: ENSMUST00000177276
AA Change: T163A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135230
Gene: ENSMUSG00000022361
AA Change: T163A

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 623 2.77e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177504
SMART Domains Protein: ENSMUSP00000135111
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Greb1l T A 18: 10,544,561 M1385K probably benign Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Olfr936 T A 9: 39,047,519 probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc30a2 T A 4: 134,349,270 probably null Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Sulf1 T A 1: 12,850,965 probably null Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zp2 A T 7: 120,135,353 probably null Het
Other mutations in Zhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zhx1 APN 15 58053315 missense probably damaging 1.00
IGL00819:Zhx1 APN 15 58054694 missense probably benign 0.00
IGL01025:Zhx1 APN 15 58054679 missense probably benign 0.32
IGL01867:Zhx1 APN 15 58054445 missense probably damaging 1.00
IGL02000:Zhx1 APN 15 58054287 missense probably damaging 1.00
IGL02093:Zhx1 APN 15 58052868 missense probably benign
IGL02156:Zhx1 APN 15 58054049 missense possibly damaging 0.89
IGL02399:Zhx1 APN 15 58053741 missense probably damaging 1.00
IGL02479:Zhx1 APN 15 58054371 missense probably damaging 1.00
R0667:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R1502:Zhx1 UTSW 15 58054596 missense probably damaging 1.00
R2923:Zhx1 UTSW 15 58053681 missense probably damaging 0.99
R3039:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R3401:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3403:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3979:Zhx1 UTSW 15 58053240 missense probably benign 0.14
R4086:Zhx1 UTSW 15 58052921 missense possibly damaging 0.93
R5013:Zhx1 UTSW 15 58054142 missense possibly damaging 0.61
R5124:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5125:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5180:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5181:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5186:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5187:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5408:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5490:Zhx1 UTSW 15 58053299 missense probably damaging 1.00
R5629:Zhx1 UTSW 15 58054811 missense probably damaging 1.00
R6314:Zhx1 UTSW 15 58054002 missense probably benign 0.01
R6768:Zhx1 UTSW 15 58054103 missense probably benign 0.27
R7081:Zhx1 UTSW 15 58054338 missense probably benign 0.00
R7211:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R7219:Zhx1 UTSW 15 58054337 missense probably benign
R7232:Zhx1 UTSW 15 58053069 missense probably benign 0.04
R7287:Zhx1 UTSW 15 58053296 missense probably damaging 1.00
R7369:Zhx1 UTSW 15 58053300 missense probably damaging 1.00
R7381:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTGAAGAACTCACACTTTCTGC -3'
(R):5'- CAATGTTGTGCTGAATTCCTCC -3'

Sequencing Primer
(F):5'- GAAGAACTCACACTTTCTGCATTTTC -3'
(R):5'- CCTCCTATGTTTGTGTTGAATGC -3'
Posted On2019-06-26