Incidental Mutation 'R7275:Greb1l'
ID565548
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7275 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10544561 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1385 (M1385K)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: M1385K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M1385K

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (64/65)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,910,021 T132S possibly damaging Het
4933412E24Rik A G 15: 60,015,889 V234A probably benign Het
Acsm5 A G 7: 119,537,288 T361A possibly damaging Het
Agxt2 G A 15: 10,358,667 R24H probably benign Het
Asb16 G T 11: 102,269,109 W96L probably damaging Het
BC037034 T C 5: 138,263,577 S86G probably benign Het
Bche T A 3: 73,700,636 T486S probably benign Het
Btbd11 T A 10: 85,654,482 L1004Q probably damaging Het
Cast T C 13: 74,727,334 T382A probably benign Het
Cdcp1 T A 9: 123,185,054 K218N possibly damaging Het
Ceacam18 G A 7: 43,641,884 G250D probably damaging Het
Ctnnd2 T C 15: 30,905,709 I834T possibly damaging Het
Cyp11b2 C A 15: 74,853,991 G136W probably damaging Het
Dis3 A G 14: 99,087,489 V502A probably damaging Het
Dnaic2 T A 11: 114,757,228 M610K unknown Het
Drosha G A 15: 12,846,083 V435I possibly damaging Het
Dsc2 T A 18: 20,051,179 R51* probably null Het
Ergic2 A T 6: 148,195,259 C170S probably damaging Het
Exoc7 A T 11: 116,304,862 probably null Het
Fbxw25 G T 9: 109,654,592 A184E Het
Gm4846 T A 1: 166,487,079 T332S probably benign Het
Gm5152 T C 5: 10,245,225 N71D Het
Grik1 T C 16: 87,912,820 N871S probably benign Het
Il11ra1 T C 4: 41,765,109 L145P probably damaging Het
Impad1 C A 4: 4,792,962 G48W probably damaging Het
Inpp5e A G 2: 26,408,092 S166P probably benign Het
Kdm4b T A 17: 56,396,333 L676H probably damaging Het
Lrp2 T A 2: 69,459,531 K3655* probably null Het
Lrrc74a A G 12: 86,740,979 N128S probably damaging Het
Map3k14 T C 11: 103,227,022 E648G probably damaging Het
Mbtps1 A T 8: 119,542,750 D200E probably benign Het
Mttp T C 3: 138,123,785 D114G probably benign Het
Mup13 G A 4: 61,226,753 T101M probably benign Het
Narfl T A 17: 25,775,134 V52E possibly damaging Het
Neb T A 2: 52,206,944 T4953S probably benign Het
Nfasc A C 1: 132,634,263 L147R probably damaging Het
Obox6 T C 7: 15,833,880 E214G probably benign Het
Olfr1054 C A 2: 86,332,792 C188F possibly damaging Het
Olfr340 A T 2: 36,452,839 M85L probably benign Het
Olfr936 T A 9: 39,047,519 probably benign Het
Opn3 T C 1: 175,665,473 N175S probably damaging Het
Osbpl3 G T 6: 50,346,430 D224E probably benign Het
Osr2 A G 15: 35,300,886 D196G probably damaging Het
Pde8b T A 13: 95,042,934 N405Y probably damaging Het
Pirb A G 7: 3,716,178 S571P probably benign Het
Psmc3 T A 2: 91,055,930 I163N probably damaging Het
Rapgef4 A G 2: 72,208,101 D532G probably damaging Het
Retreg1 A G 15: 25,971,598 D208G probably benign Het
Rgsl1 T G 1: 153,804,130 probably null Het
Ripk4 T C 16: 97,743,957 T497A probably benign Het
Slc30a2 T A 4: 134,349,270 probably null Het
Slc6a19 T C 13: 73,686,078 D335G probably benign Het
Slco4c1 G A 1: 96,871,772 T113M probably benign Het
Stxbp6 A G 12: 44,902,003 F108L probably benign Het
Sulf1 T A 1: 12,850,965 probably null Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tbc1d19 T A 5: 53,872,276 D326E probably damaging Het
Tcrg-V3 A G 13: 19,243,018 T24A probably benign Het
Trpm3 T A 19: 22,978,684 M1170K possibly damaging Het
Tubgcp6 G A 15: 89,102,943 Q1276* probably null Het
Tyrp1 A G 4: 80,837,584 K197E possibly damaging Het
Ube2cbp T C 9: 86,440,626 D165G probably damaging Het
Zfp212 A G 6: 47,920,744 T7A probably benign Het
Zhx1 T C 15: 58,054,362 T163A probably benign Het
Zp2 A T 7: 120,135,353 probably null Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7915:Greb1l UTSW 18 10542056 missense probably benign 0.38
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTCTCCCTGGACTTTG -3'
(R):5'- CAAGATGTGCCTGTTCATGTG -3'

Sequencing Primer
(F):5'- CATGGAGGTGATACAGTTAGCTAC -3'
(R):5'- CCTGTTCATGTGTAAGAGTGAAAAAC -3'
Posted On2019-06-26