Mutagenetix > Incidental Mutation

Incidental Mutation 'R7275:Greb1l'

565548

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

045358-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 10544561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1385 (M1385K)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: M1385K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M1385K

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.1176

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (64/65)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	T	A	12: 72,910,021	T132S	possibly damaging	Het
4933412E24Rik	A	G	15: 60,015,889	V234A	probably benign	Het
Acsm5	A	G	7: 119,537,288	T361A	possibly damaging	Het
Agxt2	G	A	15: 10,358,667	R24H	probably benign	Het
Asb16	G	T	11: 102,269,109	W96L	probably damaging	Het
BC037034	T	C	5: 138,263,577	S86G	probably benign	Het
Bche	T	A	3: 73,700,636	T486S	probably benign	Het
Btbd11	T	A	10: 85,654,482	L1004Q	probably damaging	Het
Cast	T	C	13: 74,727,334	T382A	probably benign	Het
Cdcp1	T	A	9: 123,185,054	K218N	possibly damaging	Het
Ceacam18	G	A	7: 43,641,884	G250D	probably damaging	Het
Ctnnd2	T	C	15: 30,905,709	I834T	possibly damaging	Het
Cyp11b2	C	A	15: 74,853,991	G136W	probably damaging	Het
Dis3	A	G	14: 99,087,489	V502A	probably damaging	Het
Dnaic2	T	A	11: 114,757,228	M610K	unknown	Het
Drosha	G	A	15: 12,846,083	V435I	possibly damaging	Het
Dsc2	T	A	18: 20,051,179	R51*	probably null	Het
Ergic2	A	T	6: 148,195,259	C170S	probably damaging	Het
Exoc7	A	T	11: 116,304,862		probably null	Het
Fbxw25	G	T	9: 109,654,592	A184E		Het
Gm4846	T	A	1: 166,487,079	T332S	probably benign	Het
Gm5152	T	C	5: 10,245,225	N71D		Het
Grik1	T	C	16: 87,912,820	N871S	probably benign	Het
Il11ra1	T	C	4: 41,765,109	L145P	probably damaging	Het
Impad1	C	A	4: 4,792,962	G48W	probably damaging	Het
Inpp5e	A	G	2: 26,408,092	S166P	probably benign	Het
Kdm4b	T	A	17: 56,396,333	L676H	probably damaging	Het
Lrp2	T	A	2: 69,459,531	K3655*	probably null	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Map3k14	T	C	11: 103,227,022	E648G	probably damaging	Het
Mbtps1	A	T	8: 119,542,750	D200E	probably benign	Het
Mttp	T	C	3: 138,123,785	D114G	probably benign	Het
Mup13	G	A	4: 61,226,753	T101M	probably benign	Het
Narfl	T	A	17: 25,775,134	V52E	possibly damaging	Het
Neb	T	A	2: 52,206,944	T4953S	probably benign	Het
Nfasc	A	C	1: 132,634,263	L147R	probably damaging	Het
Obox6	T	C	7: 15,833,880	E214G	probably benign	Het
Olfr1054	C	A	2: 86,332,792	C188F	possibly damaging	Het
Olfr340	A	T	2: 36,452,839	M85L	probably benign	Het
Olfr936	T	A	9: 39,047,519		probably benign	Het
Opn3	T	C	1: 175,665,473	N175S	probably damaging	Het
Osbpl3	G	T	6: 50,346,430	D224E	probably benign	Het
Osr2	A	G	15: 35,300,886	D196G	probably damaging	Het
Pde8b	T	A	13: 95,042,934	N405Y	probably damaging	Het
Pirb	A	G	7: 3,716,178	S571P	probably benign	Het
Psmc3	T	A	2: 91,055,930	I163N	probably damaging	Het
Rapgef4	A	G	2: 72,208,101	D532G	probably damaging	Het
Retreg1	A	G	15: 25,971,598	D208G	probably benign	Het
Rgsl1	T	G	1: 153,804,130		probably null	Het
Ripk4	T	C	16: 97,743,957	T497A	probably benign	Het
Slc30a2	T	A	4: 134,349,270		probably null	Het
Slc6a19	T	C	13: 73,686,078	D335G	probably benign	Het
Slco4c1	G	A	1: 96,871,772	T113M	probably benign	Het
Stxbp6	A	G	12: 44,902,003	F108L	probably benign	Het
Sulf1	T	A	1: 12,850,965		probably null	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Tbc1d19	T	A	5: 53,872,276	D326E	probably damaging	Het
Tcrg-V3	A	G	13: 19,243,018	T24A	probably benign	Het
Trpm3	T	A	19: 22,978,684	M1170K	possibly damaging	Het
Tubgcp6	G	A	15: 89,102,943	Q1276*	probably null	Het
Tyrp1	A	G	4: 80,837,584	K197E	possibly damaging	Het
Ube2cbp	T	C	9: 86,440,626	D165G	probably damaging	Het
Zfp212	A	G	6: 47,920,744	T7A	probably benign	Het
Zhx1	T	C	15: 58,054,362	T163A	probably benign	Het
Zp2	A	T	7: 120,135,353		probably null	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAATGTCTCCCTGGACTTTG -3'
(R):5'- CAAGATGTGCCTGTTCATGTG -3'

Sequencing Primer
(F):5'- CATGGAGGTGATACAGTTAGCTAC -3'
(R):5'- CCTGTTCATGTGTAAGAGTGAAAAAC -3'

Posted On

2019-06-26