Incidental Mutation 'R7275:Greb1l'
ID 565548
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 045358-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7275 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 10544561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1385 (M1385K)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: M1385K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: M1385K

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Meta Mutation Damage Score 0.1176 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (64/65)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik T A 12: 72,956,795 (GRCm39) T132S possibly damaging Het
4933412E24Rik A G 15: 59,887,738 (GRCm39) V234A probably benign Het
Abtb3 T A 10: 85,490,346 (GRCm39) L1004Q probably damaging Het
Acsm5 A G 7: 119,136,511 (GRCm39) T361A possibly damaging Het
Agxt2 G A 15: 10,358,753 (GRCm39) R24H probably benign Het
Asb16 G T 11: 102,159,935 (GRCm39) W96L probably damaging Het
Bche T A 3: 73,607,969 (GRCm39) T486S probably benign Het
Bpnt2 C A 4: 4,792,962 (GRCm39) G48W probably damaging Het
Cast T C 13: 74,875,453 (GRCm39) T382A probably benign Het
Cdcp1 T A 9: 123,014,119 (GRCm39) K218N possibly damaging Het
Ceacam18 G A 7: 43,291,308 (GRCm39) G250D probably damaging Het
Ciao3 T A 17: 25,994,108 (GRCm39) V52E possibly damaging Het
Ctnnd2 T C 15: 30,905,855 (GRCm39) I834T possibly damaging Het
Cyp11b2 C A 15: 74,725,840 (GRCm39) G136W probably damaging Het
Dis3 A G 14: 99,324,925 (GRCm39) V502A probably damaging Het
Dnai2 T A 11: 114,648,054 (GRCm39) M610K unknown Het
Drosha G A 15: 12,846,169 (GRCm39) V435I possibly damaging Het
Dsc2 T A 18: 20,184,236 (GRCm39) R51* probably null Het
Ergic2 A T 6: 148,096,757 (GRCm39) C170S probably damaging Het
Exoc7 A T 11: 116,195,688 (GRCm39) probably null Het
Fbxw25 G T 9: 109,483,660 (GRCm39) A184E Het
Gm4846 T A 1: 166,314,648 (GRCm39) T332S probably benign Het
Grik1 T C 16: 87,709,708 (GRCm39) N871S probably benign Het
Il11ra1 T C 4: 41,765,109 (GRCm39) L145P probably damaging Het
Inpp5e A G 2: 26,298,104 (GRCm39) S166P probably benign Het
Kdm4b T A 17: 56,703,333 (GRCm39) L676H probably damaging Het
Lrp2 T A 2: 69,289,875 (GRCm39) K3655* probably null Het
Lrrc74a A G 12: 86,787,753 (GRCm39) N128S probably damaging Het
Map3k14 T C 11: 103,117,848 (GRCm39) E648G probably damaging Het
Mbtps1 A T 8: 120,269,489 (GRCm39) D200E probably benign Het
Mttp T C 3: 137,829,546 (GRCm39) D114G probably benign Het
Mup13 G A 4: 61,182,752 (GRCm39) T101M probably benign Het
Neb T A 2: 52,096,956 (GRCm39) T4953S probably benign Het
Nfasc A C 1: 132,562,001 (GRCm39) L147R probably damaging Het
Obox6 T C 7: 15,567,805 (GRCm39) E214G probably benign Het
Opn3 T C 1: 175,493,039 (GRCm39) N175S probably damaging Het
Or1j12 A T 2: 36,342,851 (GRCm39) M85L probably benign Het
Or8g22 T A 9: 38,958,815 (GRCm39) probably benign Het
Or8k22 C A 2: 86,163,136 (GRCm39) C188F possibly damaging Het
Osbpl3 G T 6: 50,323,410 (GRCm39) D224E probably benign Het
Osr2 A G 15: 35,301,032 (GRCm39) D196G probably damaging Het
Pde8b T A 13: 95,179,442 (GRCm39) N405Y probably damaging Het
Pirb A G 7: 3,719,177 (GRCm39) S571P probably benign Het
Psmc3 T A 2: 90,886,275 (GRCm39) I163N probably damaging Het
Rapgef4 A G 2: 72,038,445 (GRCm39) D532G probably damaging Het
Retreg1 A G 15: 25,971,684 (GRCm39) D208G probably benign Het
Rgsl1 T G 1: 153,679,876 (GRCm39) probably null Het
Ripk4 T C 16: 97,545,157 (GRCm39) T497A probably benign Het
Slc30a2 T A 4: 134,076,581 (GRCm39) probably null Het
Slc6a19 T C 13: 73,834,197 (GRCm39) D335G probably benign Het
Slco4c1 G A 1: 96,799,497 (GRCm39) T113M probably benign Het
Speer1c T C 5: 10,295,192 (GRCm39) N71D Het
Stxbp6 A G 12: 44,948,786 (GRCm39) F108L probably benign Het
Sulf1 T A 1: 12,921,189 (GRCm39) probably null Het
Syt16 C T 12: 74,313,483 (GRCm39) R470C probably damaging Het
Tbc1d19 T A 5: 54,029,618 (GRCm39) D326E probably damaging Het
Trappc14 T C 5: 138,261,839 (GRCm39) S86G probably benign Het
Trgv3 A G 13: 19,427,188 (GRCm39) T24A probably benign Het
Trpm3 T A 19: 22,956,048 (GRCm39) M1170K possibly damaging Het
Tubgcp6 G A 15: 88,987,146 (GRCm39) Q1276* probably null Het
Tyrp1 A G 4: 80,755,821 (GRCm39) K197E possibly damaging Het
Ube3d T C 9: 86,322,679 (GRCm39) D165G probably damaging Het
Zfp212 A G 6: 47,897,678 (GRCm39) T7A probably benign Het
Zhx1 T C 15: 57,917,758 (GRCm39) T163A probably benign Het
Zp2 A T 7: 119,734,576 (GRCm39) probably null Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTCTCCCTGGACTTTG -3'
(R):5'- CAAGATGTGCCTGTTCATGTG -3'

Sequencing Primer
(F):5'- CATGGAGGTGATACAGTTAGCTAC -3'
(R):5'- CCTGTTCATGTGTAAGAGTGAAAAAC -3'
Posted On 2019-06-26