Mutagenetix > Incidental Mutations

Incidental Mutation 'R7275:Dsc2'

565549

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 20051179 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 51 (R51*)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

Predicted Effect

probably null
Transcript: ENSMUST00000039247
AA Change: R51*

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: R51*

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075214
AA Change: R51*

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: R51*

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000128464
AA Change: R51*

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: R51*

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	T	A	12: 72,910,021	T132S	possibly damaging	Het
4933412E24Rik	A	G	15: 60,015,889	V234A	probably benign	Het
Acsm5	A	G	7: 119,537,288	T361A	possibly damaging	Het
Agxt2	G	A	15: 10,358,667	R24H	probably benign	Het
Asb16	G	T	11: 102,269,109	W96L	probably damaging	Het
BC037034	T	C	5: 138,263,577	S86G	probably benign	Het
Bche	T	A	3: 73,700,636	T486S	probably benign	Het
Btbd11	T	A	10: 85,654,482	L1004Q	probably damaging	Het
Cast	T	C	13: 74,727,334	T382A	probably benign	Het
Cdcp1	T	A	9: 123,185,054	K218N	possibly damaging	Het
Ceacam18	G	A	7: 43,641,884	G250D	probably damaging	Het
Ctnnd2	T	C	15: 30,905,709	I834T	possibly damaging	Het
Cyp11b2	C	A	15: 74,853,991	G136W	probably damaging	Het
Dis3	A	G	14: 99,087,489	V502A	probably damaging	Het
Dnaic2	T	A	11: 114,757,228	M610K	unknown	Het
Drosha	G	A	15: 12,846,083	V435I	possibly damaging	Het
Ergic2	A	T	6: 148,195,259	C170S	probably damaging	Het
Exoc7	A	T	11: 116,304,862		probably null	Het
Fbxw25	G	T	9: 109,654,592	A184E		Het
Gm4846	T	A	1: 166,487,079	T332S	probably benign	Het
Gm5152	T	C	5: 10,245,225	N71D		Het
Greb1l	T	A	18: 10,544,561	M1385K	probably benign	Het
Grik1	T	C	16: 87,912,820	N871S	probably benign	Het
Il11ra1	T	C	4: 41,765,109	L145P	probably damaging	Het
Impad1	C	A	4: 4,792,962	G48W	probably damaging	Het
Inpp5e	A	G	2: 26,408,092	S166P	probably benign	Het
Kdm4b	T	A	17: 56,396,333	L676H	probably damaging	Het
Lrp2	T	A	2: 69,459,531	K3655*	probably null	Het
Lrrc74a	A	G	12: 86,740,979	N128S	probably damaging	Het
Map3k14	T	C	11: 103,227,022	E648G	probably damaging	Het
Mbtps1	A	T	8: 119,542,750	D200E	probably benign	Het
Mttp	T	C	3: 138,123,785	D114G	probably benign	Het
Mup13	G	A	4: 61,226,753	T101M	probably benign	Het
Narfl	T	A	17: 25,775,134	V52E	possibly damaging	Het
Neb	T	A	2: 52,206,944	T4953S	probably benign	Het
Nfasc	A	C	1: 132,634,263	L147R	probably damaging	Het
Obox6	T	C	7: 15,833,880	E214G	probably benign	Het
Olfr1054	C	A	2: 86,332,792	C188F	possibly damaging	Het
Olfr340	A	T	2: 36,452,839	M85L	probably benign	Het
Olfr936	T	A	9: 39,047,519		probably benign	Het
Opn3	T	C	1: 175,665,473	N175S	probably damaging	Het
Osbpl3	G	T	6: 50,346,430	D224E	probably benign	Het
Osr2	A	G	15: 35,300,886	D196G	probably damaging	Het
Pde8b	T	A	13: 95,042,934	N405Y	probably damaging	Het
Pirb	A	G	7: 3,716,178	S571P	probably benign	Het
Psmc3	T	A	2: 91,055,930	I163N	probably damaging	Het
Rapgef4	A	G	2: 72,208,101	D532G	probably damaging	Het
Retreg1	A	G	15: 25,971,598	D208G	probably benign	Het
Rgsl1	T	G	1: 153,804,130		probably null	Het
Ripk4	T	C	16: 97,743,957	T497A	probably benign	Het
Slc30a2	T	A	4: 134,349,270		probably null	Het
Slc6a19	T	C	13: 73,686,078	D335G	probably benign	Het
Slco4c1	G	A	1: 96,871,772	T113M	probably benign	Het
Stxbp6	A	G	12: 44,902,003	F108L	probably benign	Het
Sulf1	T	A	1: 12,850,965		probably null	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Tbc1d19	T	A	5: 53,872,276	D326E	probably damaging	Het
Tcrg-V3	A	G	13: 19,243,018	T24A	probably benign	Het
Trpm3	T	A	19: 22,978,684	M1170K	possibly damaging	Het
Tubgcp6	G	A	15: 89,102,943	Q1276*	probably null	Het
Tyrp1	A	G	4: 80,837,584	K197E	possibly damaging	Het
Ube2cbp	T	C	9: 86,440,626	D165G	probably damaging	Het
Zfp212	A	G	6: 47,920,744	T7A	probably benign	Het
Zhx1	T	C	15: 58,054,362	T163A	probably benign	Het
Zp2	A	T	7: 120,135,353		probably null	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7935:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGATGAAAATCCAAGAACACCTTC -3'
(R):5'- TGGATGTTACTATGTAACTGCGAC -3'

Sequencing Primer
(F):5'- TCCAAGAACACCTTCAAACTCAAG -3'
(R):5'- GTAACTGCGACTCAGATACAGTC -3'

Posted On

2019-06-26