Incidental Mutation 'R0584:Ccl25'
ID56557
Institutional Source Beutler Lab
Gene Symbol Ccl25
Ensembl Gene ENSMUSG00000023235
Gene Namechemokine (C-C motif) ligand 25
SynonymsCKb15, Scya25, TECK
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4325210-4360020 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 4354085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024004] [ENSMUST00000110982] [ENSMUST00000127460] [ENSMUST00000136191] [ENSMUST00000155797]
Predicted Effect probably benign
Transcript: ENSMUST00000024004
SMART Domains Protein: ENSMUSP00000024004
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110982
SMART Domains Protein: ENSMUSP00000106610
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127460
SMART Domains Protein: ENSMUSP00000120719
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
SCY 111 172 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136191
SMART Domains Protein: ENSMUSP00000117515
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
Pfam:IL8 23 66 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155797
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Ccl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ccl25 APN 8 4348700 intron probably benign
IGL02188:Ccl25 APN 8 4348552 intron probably benign
IGL03338:Ccl25 APN 8 4349898 intron probably benign
R0613:Ccl25 UTSW 8 4349850 missense probably benign 0.42
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1413:Ccl25 UTSW 8 4353892 makesense probably null
R3844:Ccl25 UTSW 8 4354183 missense possibly damaging 0.86
R4279:Ccl25 UTSW 8 4349829 missense probably damaging 1.00
R4921:Ccl25 UTSW 8 4353913 missense possibly damaging 0.92
R7021:Ccl25 UTSW 8 4349641 intron probably benign
R7033:Ccl25 UTSW 8 4349641 intron probably benign
R7630:Ccl25 UTSW 8 4353955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTACCAGCACAGGATCAAATG -3'
(R):5'- GCTGAAGGACTCAATGCACAATGC -3'

Sequencing Primer
(F):5'- CCAGCACAGGATCAAATGGAATG -3'
(R):5'- CTCAATGCACAATGCTAAAAGGG -3'
Posted On2013-07-11