Incidental Mutation 'R7276:Tecpr1'
ID565574
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7276 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 144217020 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 138 (W138*)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect probably null
Transcript: ENSMUST00000085701
AA Change: W138*
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: W138*

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8926:Tecpr1 UTSW 5 144216962 missense not run
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTTGTGGGCCTCCTATCAAG -3'
(R):5'- GAACTCAGTACCCTCCATGG -3'

Sequencing Primer
(F):5'- CCACGTCCCACCCCATG -3'
(R):5'- AGTACCCTCCATGGCTGCC -3'
Posted On2019-06-26