Incidental Mutation 'R7276:Tas2r114'
ID 565576
Institutional Source Beutler Lab
Gene Symbol Tas2r114
Ensembl Gene ENSMUSG00000063478
Gene Name taste receptor, type 2, member 114
Synonyms mt2r46, mGR14, T2R14, Tas2r14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R7276 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 131689134-131690063 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131689347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 239 (I239M)
Ref Sequence ENSEMBL: ENSMUSP00000079453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
AlphaFold Q7M722
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072404
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080619
AA Change: I239M

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478
AA Change: I239M

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Tas2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Tas2r114 APN 6 131689701 nonsense probably null
IGL02971:Tas2r114 APN 6 131689280 missense probably benign 0.00
R0561:Tas2r114 UTSW 6 131689795 missense probably benign 0.30
R3034:Tas2r114 UTSW 6 131689648 missense probably benign 0.15
R3687:Tas2r114 UTSW 6 131689268 missense probably benign 0.25
R4411:Tas2r114 UTSW 6 131689622 missense probably benign 0.06
R4826:Tas2r114 UTSW 6 131689837 missense probably damaging 0.99
R4889:Tas2r114 UTSW 6 131689795 missense probably damaging 0.96
R5084:Tas2r114 UTSW 6 131689288 nonsense probably null
R5258:Tas2r114 UTSW 6 131689541 missense probably benign 0.03
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6038:Tas2r114 UTSW 6 131689481 missense possibly damaging 0.89
R6499:Tas2r114 UTSW 6 131689136 makesense probably null
R7164:Tas2r114 UTSW 6 131689765 missense possibly damaging 0.74
R7745:Tas2r114 UTSW 6 131689438 missense probably damaging 1.00
R7851:Tas2r114 UTSW 6 131689925 missense probably damaging 1.00
R8002:Tas2r114 UTSW 6 131689139 missense probably damaging 1.00
R8901:Tas2r114 UTSW 6 131689951 missense probably damaging 0.99
R9297:Tas2r114 UTSW 6 131689324 missense probably damaging 0.96
R9380:Tas2r114 UTSW 6 131689418 missense probably benign 0.00
R9402:Tas2r114 UTSW 6 131689931 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTTGCAGTATCATTACAGAGCAC -3'
(R):5'- ACACATCTTGGCAGATCCACATG -3'

Sequencing Primer
(F):5'- GTATCATTACAGAGCACTGCTTCAGC -3'
(R):5'- AACTATGTTTTCACCAATGGGGG -3'
Posted On 2019-06-26