Incidental Mutation 'R7276:Zfp111'
ID565580
Institutional Source Beutler Lab
Gene Symbol Zfp111
Ensembl Gene ENSMUSG00000087598
Gene Namezinc finger protein 111
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7276 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24193947-24211443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24199553 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 212 (C212F)
Ref Sequence ENSEMBL: ENSMUSP00000129484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056683] [ENSMUST00000073833] [ENSMUST00000086006]
Predicted Effect probably damaging
Transcript: ENSMUST00000056683
AA Change: C212F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129484
Gene: ENSMUSG00000087598
AA Change: C212F

DomainStartEndE-ValueType
KRAB 9 64 1.8e-21 SMART
low complexity region 114 128 N/A INTRINSIC
ZnF_C2H2 210 232 2.3e-7 SMART
ZnF_C2H2 266 288 5.7e-4 SMART
ZnF_C2H2 294 316 3.3e-4 SMART
ZnF_C2H2 322 343 4.3e-1 SMART
ZnF_C2H2 349 371 4.5e-8 SMART
ZnF_C2H2 377 399 2.1e-6 SMART
ZnF_C2H2 405 427 8e-6 SMART
ZnF_C2H2 433 455 9.9e-5 SMART
ZnF_C2H2 461 481 4.3e-2 SMART
ZnF_C2H2 489 511 2.7e-5 SMART
ZnF_C2H2 517 539 1.1e-6 SMART
ZnF_C2H2 545 567 1.8e-5 SMART
ZnF_C2H2 573 595 3.5e-6 SMART
ZnF_C2H2 601 623 2.9e-6 SMART
ZnF_C2H2 629 651 1.3e-6 SMART
ZnF_C2H2 657 679 2.2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073833
AA Change: C211F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083174
Gene: ENSMUSG00000087598
AA Change: C211F

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086006
AA Change: C211F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083169
Gene: ENSMUSG00000087598
AA Change: C211F

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Zfp111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02569:Zfp111 APN 7 24207069 missense possibly damaging 0.91
IGL02619:Zfp111 APN 7 24199688 missense possibly damaging 0.75
FR4737:Zfp111 UTSW 7 24199805 small insertion probably benign
FR4976:Zfp111 UTSW 7 24199037 missense probably damaging 0.97
FR4976:Zfp111 UTSW 7 24199807 small insertion probably benign
R0514:Zfp111 UTSW 7 24199143 missense probably damaging 0.96
R3837:Zfp111 UTSW 7 24199466 missense possibly damaging 0.53
R4682:Zfp111 UTSW 7 24199138 missense probably damaging 0.98
R4844:Zfp111 UTSW 7 24199376 missense probably damaging 0.99
R6105:Zfp111 UTSW 7 24203366 splice site probably null
R6175:Zfp111 UTSW 7 24198129 missense unknown
R7584:Zfp111 UTSW 7 24198600 missense possibly damaging 0.89
X0018:Zfp111 UTSW 7 24199991 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTCAAGTTGAAGGGCTTCCC -3'
(R):5'- TCTTGGGGTAAAAGACGTCTTAGG -3'

Sequencing Primer
(F):5'- AATCACACTTGGACGGTTTGC -3'
(R):5'- TCTTAGGAAAAGACAGAACCATCAG -3'
Posted On2019-06-26