Incidental Mutation 'R7276:Olfr671'
ID565584
Institutional Source Beutler Lab
Gene Symbol Olfr671
Ensembl Gene ENSMUSG00000094531
Gene Nameolfactory receptor 671
SynonymsGA_x6K02T2PBJ9-7604826-7603885, MOR32-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7276 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104972896-104979126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104975650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 116 (M116L)
Ref Sequence ENSEMBL: ENSMUSP00000148008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078710] [ENSMUST00000210963] [ENSMUST00000217091]
Predicted Effect probably benign
Transcript: ENSMUST00000078710
AA Change: M112L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077774
Gene: ENSMUSG00000094531
AA Change: M112L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.4e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 3.7e-7 PFAM
Pfam:7tm_1 43 293 1.5e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210963
AA Change: M116L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217091
AA Change: M116L

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Olfr671
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr671 APN 7 104975986 splice site probably null
IGL02154:Olfr671 APN 7 104975981 start codon destroyed probably null 0.14
IGL02308:Olfr671 APN 7 104975458 missense possibly damaging 0.84
IGL02794:Olfr671 APN 7 104975389 missense probably benign
R0919:Olfr671 UTSW 7 104975312 nonsense probably null
R1819:Olfr671 UTSW 7 104975398 missense probably benign 0.01
R1972:Olfr671 UTSW 7 104975899 missense possibly damaging 0.63
R2025:Olfr671 UTSW 7 104975244 missense probably benign 0.01
R4910:Olfr671 UTSW 7 104975479 missense possibly damaging 0.88
R5442:Olfr671 UTSW 7 104975228 missense possibly damaging 0.80
R5554:Olfr671 UTSW 7 104975982 start codon destroyed probably null 0.99
R5932:Olfr671 UTSW 7 104975655 missense probably damaging 1.00
R6683:Olfr671 UTSW 7 104975968 missense probably benign
R6962:Olfr671 UTSW 7 104975373 missense probably benign 0.00
R7000:Olfr671 UTSW 7 104975131 missense probably damaging 1.00
R7059:Olfr671 UTSW 7 104976017 splice site probably null
R7425:Olfr671 UTSW 7 104975061 nonsense probably null
R7688:Olfr671 UTSW 7 104975125 missense possibly damaging 0.60
R8043:Olfr671 UTSW 7 104975873 nonsense probably null
R8074:Olfr671 UTSW 7 104975727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATGTGCTCACAGTAAG -3'
(R):5'- AGCTGAACACAGTCTTCATGAGC -3'

Sequencing Primer
(F):5'- CCCATGTGCTCACAGTAAGTATGAG -3'
(R):5'- ATGAGCCCATGTACTACTTCCTAG -3'
Posted On2019-06-26